Национальный цифровой ресурс Руконт - межотраслевая электронная библиотека (ЭБС) на базе технологии Контекстум (всего произведений: 507300)
Консорциум Контекстум Информационная технология сбора цифрового контента
Уважаемые СТУДЕНТЫ и СОТРУДНИКИ ВУЗов, использующие нашу ЭБС. Рекомендуем использовать новую версию сайта.
  Расширенный поиск
Результаты поиска

Нашлось результатов: 2099 (1,27 сек)

Свободный доступ
Ограниченный доступ
Уточняется продление лицензии
1

РОЛЬ ОСТАТКА ЛИЗИНА В АНТИОКСИДАНТНОЙ И ДНК-ПРОТЕКТОРНОЙ АКТИВНОСТИ ОЛИГОПЕПТИДОВ [Электронный ресурс] / Празднова [и др.] // Успехи геронтологии / Advances in Gerontology .— 2016 .— №5 .— С. 97-104 .— Режим доступа: https://rucont.ru/efd/578376

Автор: Празднова

Присутствующие в клетке олигопептиды проявляют антиоксидантные свойства и участвуют в регуляции антиоксидантного баланса, в частности путем взаимодействия с редокс-зависимыми клеточными сигнальными каскадами. В отличие от экспериментов на животных, доказывающих геропротекторное и адаптогенное влияние олигопептидов, в данной работе изучено действие ряда синтетических олигопептидов на клетку с использованием бактериальных моделей. Такой подход позволяет оценить именно антиоксидантные свойства соединений, не затрагивая их участие в регуляторных каскадах, характерных для клеток эукариот. Эксперименты с бактериальными luxбиосенсорами показали, что способность олигопептидов защищать клетки от действия физических прооксидантных факторов (УФ-облучение) связана с наличием в молекуле остатка лизина. Для химических прооксидантов (диоксидин) наблюдается схожая, хоть и менее строгая закономерность. Описанный эффект также коррелирует с ДНК-протекторной активностью исследуемых олигопептидов

MG 1655 (KatG-lux) 10–4 3,77 Диоксидин E. coli MG 1655 (RecA-lux) 10–3 34,03 Пероксид водорода E.coli <...> MG 1655 (KatG-lux) 10–6 42,85 Везуген УФ311 нм E. coli MG 1655 (RecA-lux) 10–7 8,07 E. coli MG 1655 <...> (KatG-lux) 10–4 19,7 Диоксидин E. coli MG 1655 (RecA-lux) 10–3 62,74 Пероксид водорода E. coli MG 1655 <...> (KatG-lux) 10–7 23,59 Изовилон УФ311 нм E. coli MG 1655 (RecA-lux) 10–7 31,65 E. coli MG 1655 (KatG-lux <...> ) – – Диоксидин E. coli MG 1655 (RecA-lux) 10–5 72,93 Пероксид водорода E. coli MG 1655 (KatG-lux) 10

2

Методы биолюминесцентного тестирования метод. указания к лаб. практикуму

Автор: Алешина
ГОУ ОГУ

Лабораторный практикум посвящен методам тестирования абиотических и биологических сред с использованием рекомбинантных люминесцирующих бактерий. Каждая лабораторная работа включает теоретический материал, описание методики проведения работы и оформления результатов.

или nblA::lux-опероном чувствительны к биодоступному азоту. <...> '::lux SOS-ответ на повреждение ДНК (синтез системы белков LexA-RecA) ультрафиолет митомицин С 25 Вт/ <...> '::lux (или E. coli colD::lux) выращивают на LB-агаре с селективным маркером (ампициллин в концентрации <...> ’::lux (или E.coli colD’::lux); 4) установить планшет в люминометр и запустить процесс измерения люминесценции <...> ’::lux (или E.coli colD’::lux) под воздействием модельных генотоксикантов, что обуславливает эффективность

Предпросмотр: Методы биолюминесцентного тестирования.pdf (0,1 Мб)
3

ДЕТЕКЦИЯ СЫРОЙ НЕФТИ ПРИ ПОМОЩИ БАКТЕРИАЛЬНЫХ LUX-БИОСЕНСОРОВ [Электронный ресурс] / Празднова [и др.] // Известия высших учебных заведений. Северо-Кавказский регион. Естественные науки .— 2011 .— №4 .— С. 109-112 .— Режим доступа: https://rucont.ru/efd/426484

Автор: Празднова

Рассматривается новая методика детекции нефти и нефтепродуктов в водной среде при помощи бактериальных биосенсоров. Генноинженерный штамм E.coli (RecA-lux) и природный биолюминесцентный штамм Vibrio Fischeri, выделенный из вод Черного моря, позволяют определить концентрацию нефтепродуктов в пробах воды в диапазоне концентраций 10– 10мг/л. Принципиальная новизна данного метода по сравнению с уже существующими заключается в статусе нефтепродуктов в тестсистеме, являющихся в данном случае не субстратом, а токсикантом.

Генноинженерный штамм E.coli (RecA-lux) и природный биолюминесцентный штамм Vibrio Fischeri, выделенный <...> Gene-modified strain of E.coli MG1655 (RecA-luх ) and native strain of Vibrio Fischeri extracted from <...> соответствующих промоторов katG, soxS и recA [10], а также природный штамм V.fisheri NB 15, выделенный <...> под контролем recA промотора позволяет достоверно определить нефть в среде в диапазоне концентраций 10 <...> Таким образом, чувствительность использованного нами RecA-биосенсора позволяет определять присутствие

4

№5 [Успехи геронтологии / Advances in Gerontology, 2016]

Выходит с 1997 г. Основной задачей журнала является содействие развитию исследований в области отечественной геронтологической науки и смежных направлениях физиологии и биологии и внедрению результатов исследований в практику.

MG 1655 (KatG-lux) 10–4 3,77 Диоксидин E. coli MG 1655 (RecA-lux) 10–3 34,03 Пероксид водорода E.coli <...> MG 1655 (KatG-lux) 10–6 42,85 Везуген УФ311 нм E. coli MG 1655 (RecA-lux) 10–7 8,07 E. coli MG 1655 <...> (KatG-lux) 10–4 19,7 Диоксидин E. coli MG 1655 (RecA-lux) 10–3 62,74 Пероксид водорода E. coli MG 1655 <...> (KatG-lux) 10–7 23,59 Изовилон УФ311 нм E. coli MG 1655 (RecA-lux) 10–7 31,65 E. coli MG 1655 (KatG-lux <...> ) – – Диоксидин E. coli MG 1655 (RecA-lux) 10–5 72,93 Пероксид водорода E. coli MG 1655 (KatG-lux) 10

Предпросмотр: Успехи геронтологии Advances in Gerontology №5 2016.pdf (0,5 Мб)
5

ДЕТЕКЦИЯ СЫРОЙ НЕФТИ ПРИ ПОМОЩИ БАКТЕРИАЛЬНЫХ LUX-БИОСЕНСОРОВ [Электронный ресурс] / Празднова [и др.] // Известия высших учебных заведений. Северо-Кавказский регион. Естественные науки .— 2011 .— №4 .— С. 88-91 .— Режим доступа: https://rucont.ru/efd/426479

Автор: Празднова

Рассматривается новая методика детекции нефти и нефтепродуктов в водной среде при помощи бактериальных биосенсоров. Генноинженерный штамм E.coli (RecA-lux) и природный биолюминесцентный штамм Vibrio Fischeri, выделенный из вод Черного моря, позволяют определить концентрацию нефтепродуктов в пробах воды в диапазоне концентраций 10– 10мг/л. Принципиальная новизна данного метода по сравнению с уже существующими заключается в статусе нефтепродуктов в тестсистеме, являющихся в данном случае не субстратом, а токсикантом.

Генноинженерный штамм E.coli (RecA-lux) и природный биолюминесцентный штамм Vibrio Fischeri, выделенный <...> Gene-modified strain of E.coli MG1655 (RecA-luх ) and native strain of Vibrio Fischeri extracted from <...> соответствующих промоторов katG, soxS и recA [10], а также природный штамм V.fisheri NB 15, выделенный <...> метаболической активации, при воздействии относительно низкими концентрациями нефти (10-3÷10-1 мг/л) RecA-биосенсор <...> под контролем recA промотора позволяет достоверно определить нефть в среде в диапазоне концентраций 10

6

АНАЛИЗ ПРИМЕНИМОСТИ МОДЕЛИ МОНО К ОПИСАНИЮ БИОДЕГРАДАЦИИ Н-ТРИДЕКАНА В ПОЧВЕ НА ОСНОВЕ ЭКСПЕРИМЕНТАЛЬНЫХ ДАННЫХ [Электронный ресурс] / Поташев [и др.] // Известия высших учебных заведений. Северо-Кавказский регион. Естественные науки .— 2011 .— №4 .— С. 84-88 .— Режим доступа: https://rucont.ru/efd/426478

Автор: Поташев

Представлены результаты экспериментального исследования биодеградации н-тридекана в выщелоченном черноземе. Исследованы две стадии процесса, отличающиеся по динамике дыхания микроорганизмов и потребления ими загрязнителя. Сформулирована упрощенная математическая модель биодеградации н-тридекана. На основе полученных экспериментальных данных определены числовые значения основных коэффициентов модели: максимальной скорости роста численности микроорганизмов в загрязненной почве, скорости гибели микроорганизмов и коэффициента потребления ими загрязнителя.

УДК 574, 579, 57.08 ДЕТЕКЦИЯ СЫРОЙ НЕФТИ ПРИ ПОМОЩИ БАКТЕРИАЛЬНЫХ LUX-БИОСЕНСОРОВ © 2011 г. Е.В. <...> Генноинженерный штамм E.coli (RecA-lux) и природный биолюминесцентный штамм Vibrio Fischeri, выделенный <...> Gene-modified strain of E.coli MG1655 (RecA-luх ) and native strain of Vibrio Fischeri extracted from

7

№4 [Известия высших учебных заведений. Северо-Кавказский регион. Естественные науки, 2011]

Научно-образовательный и прикладной журнал «Известия Высших учебных заведений. Северо-Кавказский регион» существует более 40 лет, зарегистрирован в Комитете Российской Федерации по печати (регистрационные номера 011018, 011019, 011020). В состав его редколлегий входят ведущие ученые вузов Северного Кавказа. Он был создан в 1972 г. по инициативе чл.-кор. РАН, доктора химических наук, профессора Ю.А. Жданова, ставшего его главным редактором, с целью интеграции ученых Северного Кавказа для решения актуальных проблем науки и народнохозяйственных задач. Тогда журнал носил название «Известия Северо-Кавказского научного центра высшей школы». С началом перестройки изменилось не только название, но и условия финансирования. Сегодня издание журнала осуществляется при частичной финансовой поддержке его соучредителей — 15 вузов Северного Кавказа (отсюда и название). На его страницах стали печататься статьи ученых как Северного Кавказа, так и стран ближнего и дальнего зарубежья по широкому спектру научных, прикладных и образовательных проблем, отражающих развитие науки в следующих сферах:математика и механика, биология, науки о Земле.

Генноинженерный штамм E.coli (RecA-lux) и природный биолюминесцентный штамм Vibrio Fischeri, выделенный <...> Gene-modified strain of E.coli MG1655 (RecA-luх ) and native strain of Vibrio Fischeri extracted from <...> Генноинженерный штамм E.coli (RecA-lux) и природный биолюминесцентный штамм Vibrio Fischeri, выделенный <...> Gene-modified strain of E.coli MG1655 (RecA-luх ) and native strain of Vibrio Fischeri extracted from <...> Таким образом, чувствительность использованного нами RecA-биосенсора позволяет определять присутствие

Предпросмотр: Известия высших учебных заведений. Северо-Кавказский регион. Естественные науки №4 2011.pdf (0,8 Мб)
8

№3 [Молекулярная генетика, микробиология и вирусология, 2015]

Основан в 1983 г. Главный редактор журнала - Костров Сергей Викторович - член-корреспондент РАН, профессор, доктор биологических наук, директор Института молекулярной генетики РАН. Журнал освещает наиболее актуальные теоретические и прикладные проблемы молекулярной генетики про- и эукариотных организмов, молекулярной микробиологии и молекулярной вирусологии. Важную роль журнал отводит исследованиям генетического аппарата микроорганизмов, изысканиям форм генетического обмена, генетического картирования патогенных возбудителей, выяснению строения и функций внехромосомных факторов наследственности и мигрирующих генетических элементов, теоретическим исследованиям механизмов генетической регуляции. Публикует результаты исследований молекулярных и генетических основ эукариотной клетки, функционирования хромосом и хроматина, природы генетических изменений при злокачественном перерождении и ряде наследственных заболеваний. На страницах журнала освещается разработка молекулярных основ вирусологии, в том числе вопросы интеграции вирусных и клеточных геномов, вопросы персистенции.

Активированный recA (recA*) вызывает аутораспад SetR, репрессию s086, экспрессию setD и setC. <...> Как показал анализ с помощью биочипов, повышение образования пневмолизина регулируется системой luxs <...> Результаты показали, что luxs-протеин необходим для образования ранней биопленки. <...> (в плазмиде pGM∆recA) соответственно. <...> Аллельный обмен гена recA.

Предпросмотр: Молекулярная генетика, микробиология и вирусология №3 2015.pdf (8,2 Мб)
9

ДИОКСИДИН ИНДУЦИРУЕТ АНТИБИОТИКОРЕЗИСТЕНТНОСТЬ БАКТЕРИЙ [Электронный ресурс] / Мазанко [и др.] // Молекулярная генетика, микробиология и вирусология .— 2016 .— №4 .— С. 31-36 .— Режим доступа: https://rucont.ru/efd/565481

Автор: Мазанко

Изучалась способность медицинского препарата диоксидина вызывать образование антибиотикорезистентности у бактерий. Исследование проводилось с помощью биолюминесцентного теста с использованием рекомбинантных штаммов Escherichia coli MG 1655 (pSoxS-lux), MG1655 (pKatG-lux), MG1655 (pRecA-lux), MG1655 (pColD-lux), в геном которых введены плазмиды с опероном luxCDABE фотобактерии Photorhabdus luminescens, поставленным под контроль соответствующих стресс-индуцируемых промоторов E. coli, а также классических методик учета частоты образования устойчивых мутантов для непатогенных и условнопатогенных штаммов Escherichia coli, Bacillus amyloliquefaciens и Klebsiella pneumoniae

), Mg1655 (pKatg-lux), Mg1655 (precA-lux), Mg1655 (pColD-lux), в геном которых введены плазмиды с опероном <...> ), Mg1655 (pKatg-lux), Mg1655 (precA-lux), Mg1655 (pColD-lux), содержащие плазмиды с опероном luxCDABe <...> PrecA при нормальном метаболизме, без sosиндукции, поскольку продукт регулируемого им гена — белок recA <...> Для штамма E. coli Mg1655 (Katg-lux) КИ составил 3,96; для штамма E. coli Mg1655 (soxs-lux) — 4,97. <...> ), Mg1655 (pKatg-lux), Mg1655 (precA-lux), Mg1655 (pColD-lux), whose genome contains a plasmid with operon

10

№2 [Биологические мембраны: Журнал мембранной и клеточной биологии , 2017]

Публикует статьи и обзоры, освещающие различные, прежде всего физико-химические, аспекты мембранной и клеточной биологии. К ним относятся: структура мембран, их липидный состав и физико-химические свойства, а также структура мембранных белков. Особое внимание уделяется биоэнергетике, мембранному транспорту, процессам рецепции и регуляции, которые ответственны за передачу информации. Значительное место отводится работам, посвященным изучению межклеточных контактов и взаимодействий, а также структуры и функции внутриклеточных мембранных образований. В журнале публикуются фундаментальные исследования биомедицинского характера, в том числе посвященные мембранным аспектам иммунологии. Журнал предназначен для специалистов, молодых исследователей и студентов старших курсов, работающих в области биофизики, биохимии и клеточной биологии.

№ 2 2017 СОВРЕМЕННЫЕ ПРЕДСТАВЛЕНИЯ О МЕХАНИЗМАХ ТРАНСПОРТА 81 стым (результирующим) потоком (net f lux <...> Sodium, net acid and ammonia f luxes in freshwater-adapted European flounder (Platichthys flesus L.). <...> Поступление рекомбинантного белка RecA в митохондрии обеспечивалось за счет некодирующих областей 3'- <...> Action potentials in Acetabularia: measurement and simulation of voltagegated f luxes. J. Membr. <...> Buffer capacities of leaves, leaf cells, and leaf cell organelles in relation to f luxes of potentially

Предпросмотр: Биологические мембраны Журнал мембранной и клеточной биологии №2 2017.pdf (0,1 Мб)
11

ИСПОЛЬЗОВАНИЕ БИОСЕНСОРОВ ДЛЯ ДЕТЕКЦИИ АНТРОПОГЕННОГО ЗАГРЯЗНЕНИЯ ПРИРОДНЫХ ВОД [Электронный ресурс] / Сазыкина, Мирина, Сазыкин // Вода: химия и экология .— 2015 .— №10 .— С. 68-78 .— Режим доступа: https://rucont.ru/efd/525928

Автор: Сазыкина

На основе анализа литературы отечественных и зарубежных авторов оценена актуальность применения биосенсорных систем для детекции широкого спектра токсичных веществ антропогенного происхождения в объектах окружающей среды, в том числе для выявления загрязнения природных вод. Рассмотрены биосенсоры на основе ферментов, иммунных комплексов, ДНК, микроорганизмов, тканей растений и животных, БПКбиосенсоры, специфичные микробные сенсорные системы, сенсоры на основе биолюминесцентных бактерий Проанализированы принципы их действия, чувствительность, перспективность использования для экспрессоценки загрязнения природных вод токсикантами с целью повышения эффективности экологического мониторинга. Исследованы основные тенденции развития биосенсорных систем, включающие способы повышения их селективности и чувствительности, поиск новых подходов к улучшению характеристик биосенсорной детекции, использование технологий рекомбинантных ДНК для получения микроорганизмов с заданными свойствами и пр.

ДНК было сконструировано большое количество штаммов, но наиболее чувствительными среди них оказались recA-штаммы <...> В настоящее время разработано большое количество lux-биосенсоров, регистрирующих окислительный стресс <...> Improved bacterial SOS promoter∷lux fusions for genotoxicity detection / Y. Davidov, R. <...> Improved bacterial SOS promoter∷lux fusions for genotoxicity detection. Mutat. Res. Genet. <...> microorganisms as environmental biosensors: pollutants detection by Escherichia coli bearing fabA’::lux

12

ИСПОЛЬЗОВАНИЕ БИОСЕНСОРОВ ДЛЯ ДЕТЕКЦИИ АНТРОПОГЕННОГО ЗАГРЯЗНЕНИЯ ПРИРОДНЫХ ВОД [Электронный ресурс] / Сазыкина [и др.] // Вода: химия и экология .— 2015 .— №10 .— С. 68-78 .— Режим доступа: https://rucont.ru/efd/421192

Автор: Сазыкина

На основе анализа литературы отечественных и зарубежных авторов оценена актуальность применения биосенсорных систем для детекции широкого спектра токсичных веществ антропогенного происхождения в объектах окружающей среды, в том числе для выявления загрязнения природных вод. Рассмотрены биосенсоры на основе ферментов, иммунных комплексов, ДНК, микроорганизмов, тканей растений и животных, БПКбиосенсоры, специфичные микробные сенсорные системы, сенсоры на основе биолюминесцентных бактерий. Проанализированы принципы их действия, чувствительность, перспективность использования для экспрессоценки загрязнения природных вод токсикантами с целью повышения эффективности экологического мониторинга. Исследованы основные тенденции развития биосенсорных систем, включающие способы повышения их селективности и чувствительности, поиск новых подходов к улучшению характеристик биосенсорной детекции, использование технологий рекомбинантных ДНК для получения микроорганизмов с заданными свойствами и пр.

ДНК было сконструировано большое количество штаммов, но наиболее чувствительными среди них оказались recA-штаммы <...> В настоящее время разработано большое количество lux-биосенсоров, регистрирующих окислительный стресс <...> Improved bacterial SOS promoter∷lux fusions for genotoxicity detection / Y. Davidov, R. <...> Improved bacterial SOS promoter∷lux fusions for genotoxicity detection. Mutat. Res. Genet. <...> microorganisms as environmental biosensors: pollutants detection by Escherichia coli bearing fabA’::lux

13

ИСПОЛЬЗОВАНИЕ БИОСЕНСОРОВ ДЛЯ ДЕТЕКЦИИ АНТРОПОГЕННОГО ЗАГРЯЗНЕНИЯ ПРИРОДНЫХ ВОД [Электронный ресурс] / Сазыкина, Мирина, Сазыкин // Вода: химия и экология .— 2015 .— №10 .— С. 68-78 .— Режим доступа: https://rucont.ru/efd/380452

Автор: Сазыкина

На основе анализа литературы отечественных и зарубежных авторов оценена актуальность применения биосенсорных систем для детекции широкого спектра токсичных веществ антропогенного происхождения в объектах окружающей среды, в том числе для выявления загрязнения природных вод. Рассмотрены биосенсоры на основе ферментов, иммунных комплексов, ДНК, микроорганизмов, тканей растений и животных, БПКбиосенсоры, специфичные микробные сенсорные системы, сенсоры на основе биолюминесцентных бактерий.

ДНК было сконструировано большое количество штаммов, но наиболее чувствительными среди них оказались recA-штаммы <...> В настоящее время разработано большое количество lux-биосенсоров, регистрирующих окислительный стресс <...> Improved bacterial SOS promoter∷lux fusions for genotoxicity detection / Y. Davidov, R. <...> Improved bacterial SOS promoter∷lux fusions for genotoxicity detection. Mutat. Res. Genet. <...> microorganisms as environmental biosensors: pollutants detection by Escherichia coli bearing fabA’::lux

14

№12 [Генетика, 2017]

Журнал Генетика был основан в 1965 году, вскоре после окончания эры лысенковщины, когда генетика считалась реакционной псевдонаукой. Журнал внес значительный вклад в возрождение генетики в Советском Союзе. В журнале Генетика публикуются как обзоры, так и экспериментальные статьи в области теоретической и прикладной генетики, отражающие фундаментальные исследования генетических процессов на молекулярном, клеточном, организменном и популяционном уровнях. Особое внимание уделяется наиболее актуальным проблемам современной генетики, касающимся глобальных вопросов общемирового значения, таких как сохранение и рациональное использование генетических ресурсов и оценка, прогнозирование и предупреждение негативных генетических последствий загрязнения окружающей среды.

Эти однонитчатые концы покрываются белком, подобным RecA-белку E. coli. <...> Функцию RecA-белка у C. elegans выполняет только белок RAD-51. <...> Kuntze на штаммах E. coli MG1655 (pColD-lux), Е. coli MG1655 (pSoxS-lux) и E. coli MG1655 (pKatG-lux) <...> ), E. coli MG1655 (pKatG-lux), E. coli MG1655 (pColD-lux). <...> Kuntze in E. coli strains MG1655 (pColD-lux), MG1655 (pSoxS-lux), and MG1655 (pKatG-lux) were studied

Предпросмотр: Генетика №12 2017.pdf (0,1 Мб)
15

№2 [Вестник Пермского университета. Серия Биология=Bulletin of Perm University. BIOLOGY, 2010]

Издание включает как теоретические работы, так и статьи, содержащие результаты конкретных исследований по ботанике и физиологии растений, ихтиологии и этологии, энтомологии и гидробиологии, микробиологии, почвоведению. Медико-биологическим проблемам, биоэкологи и охране природы, а также рецензии на некоторые публикации. Все статьи проходят рецензирование.

репортерного штамма (5 ч контакта) с метаболитами E. coli K12 показало обратную картину зависимости экспрессии lux-оперона <...> Экспрессирующиеся вторыми: recA recN RecA-копротеаза/SOSдерепрессор, рекомбинационная репарация, RecN <...> Одновременное участие RecA в репарации и рекомбинации было определено в двойных мутантах recA uvrA. <...> Повреждение ДНК является сигналом для превращения RecA в активированную форму RecA*, что способствует <...> of recA // J.

Предпросмотр: Вестник Пермского университета. Серия Биология №2 2010.pdf (0,6 Мб)
16

№4 [Молекулярная генетика, микробиология и вирусология, 2016]

Основан в 1983 г. Главный редактор журнала - Костров Сергей Викторович - член-корреспондент РАН, профессор, доктор биологических наук, директор Института молекулярной генетики РАН. Журнал освещает наиболее актуальные теоретические и прикладные проблемы молекулярной генетики про- и эукариотных организмов, молекулярной микробиологии и молекулярной вирусологии. Важную роль журнал отводит исследованиям генетического аппарата микроорганизмов, изысканиям форм генетического обмена, генетического картирования патогенных возбудителей, выяснению строения и функций внехромосомных факторов наследственности и мигрирующих генетических элементов, теоретическим исследованиям механизмов генетической регуляции. Публикует результаты исследований молекулярных и генетических основ эукариотной клетки, функционирования хромосом и хроматина, природы генетических изменений при злокачественном перерождении и ряде наследственных заболеваний. На страницах журнала освещается разработка молекулярных основ вирусологии, в том числе вопросы интеграции вирусных и клеточных геномов, вопросы персистенции.

ы В работе использовали бактериальные штаммы E. coli M15 [preP4] (F-, Φ80ΔlacM15, thi, lac-, mtl-, recA <...> ), Mg1655 (pKatg-lux), Mg1655 (precA-lux), Mg1655 (pColD-lux), в геном которых введены плазмиды с опероном <...> ), Mg1655 (pKatg-lux), Mg1655 (precA-lux), Mg1655 (pColD-lux), содержащие плазмиды с опероном luxCDABe <...> PrecA при нормальном метаболизме, без sosиндукции, поскольку продукт регулируемого им гена — белок recA <...> ), Mg1655 (pKatg-lux), Mg1655 (precA-lux), Mg1655 (pColD-lux), whose genome contains a plasmid with operon

Предпросмотр: Молекулярная генетика, микробиология и вирусология №4 2016.pdf (1,1 Мб)
17

№14 [Доклады Академии Наук, 2018]

Один из крупнейших в мире научных журналов, орган Президиума Российской академии наук. Основное назначение журнала – прежде всего в публикации сообщений о крупных научных исследованиях, имеющих приоритетный характер, и оригинальных, нигде ранее не опубликованных исследованиях в области физико-математических, технических, геологических и биологических наук.

(pColD–Lux), несущие рекомбинантную плазмиду с lux-опероном люминесцирующей бактерии Photorhabdus luminescens <...> Биосенсоры MG1655 (pRecA–Lux) и MG1655 (pColD–Lux) люминесцируют в результате активации промоторов PRecА <...> ) и MG1655 (pRecA–Lux) соответственно. <...> Таким образом, используемые нами биосенсоры MG1655 (pRecA–Lux) и MG1655 (pColD–Lux) отражают экспрессию <...> 1,6 ± 0,1 НММ 10–2 E. coli (pColD-Lux) 1,3 ± 0,2 1,4 ± 0,1 1,4 ± 0,1 1,4 ± 0,2 10–2 E. coli (pRecA–Lux

Предпросмотр: Доклады Академии Наук №14 2018.pdf (0,2 Мб)
18

№4 [Молекулярная генетика, микробиология и вирусология, 2014]

Основан в 1983 г. Главный редактор журнала - Костров Сергей Викторович - член-корреспондент РАН, профессор, доктор биологических наук, директор Института молекулярной генетики РАН. Журнал освещает наиболее актуальные теоретические и прикладные проблемы молекулярной генетики про- и эукариотных организмов, молекулярной микробиологии и молекулярной вирусологии. Важную роль журнал отводит исследованиям генетического аппарата микроорганизмов, изысканиям форм генетического обмена, генетического картирования патогенных возбудителей, выяснению строения и функций внехромосомных факторов наследственности и мигрирующих генетических элементов, теоретическим исследованиям механизмов генетической регуляции. Публикует результаты исследований молекулярных и генетических основ эукариотной клетки, функционирования хромосом и хроматина, природы генетических изменений при злокачественном перерождении и ряде наследственных заболеваний. На страницах журнала освещается разработка молекулярных основ вирусологии, в том числе вопросы интеграции вирусных и клеточных геномов, вопросы персистенции.

В работе были использованы в качестве биосенсоров N-ацил-гомосеринлактонов три lux-репортерных штамма <...> К л ю ч е в ы е с л о в а : кетоны, Quorum Sensing; lux-биосенсоры. <...> Штамм Характеристика Происхождение или ссылка Escherichia coli DH5α FendA1 hsdR17 (rkmk+) supE44 thi-1 recA1 <...> Ни в одном случае не обнаружено стимуляции кетонами экспрессии репортерного lux-оперона. <...> K e y w o r d s : ketones, Quorum Sensing, lux-biosensors.

Предпросмотр: Молекулярная генетика, микробиология и вирусология №4 2014.pdf (1,1 Мб)
19

МУЛЬТИЛОКУСНОЕ СИКВЕНС-ТИПИРОВАНИЕ ШТАММОВ VIBRIO CHOLERAE РАЗНОЙ ЭПИДЕМИЧЕСКОЙ ЗНАЧИМОСТИ [Электронный ресурс] / Миронова [и др.] // Молекулярная генетика, микробиология и вирусология .— 2015 .— №2 .— С. 28-34 .— Режим доступа: https://rucont.ru/efd/399090

Автор: Миронова

Проведено исследование аллельного полиморфизма генов «домашнего хозяйства» (dnaE, lap, recA, pgm, gyrB, cat, chi, gmd) штаммов Vibriocholerae разной эпидемической значимости (n= 41), изолированных на территории Сибири и Дальнего Востока в период VII пандемии холеры. Установлено, что все токсигенные штаммы периода эпидемических осложнений независимо от времени и источника выделения характеризуются идентичным аллельным профилем и относятся к одному сиквенс-тииу. Среди эпидемически неопасных изолятов выявлено 9 сиквенс-тинов и кластеризация их на дендрограмме, ассоциированная с принадлежностью к серогруппе и, в ряде случаев, с территорией и временем выделения. Гетерогенность структуры генов «домашнего хозяйства», нетоксигенных V. cholera, обусловлена преимущественно синонимичными нуклеотидными заменами (Dn/Ds

Иркутск Проведено исследование аллельного полиморфизма генов «домашнего хозяйства» (dnaE, lap, recA, <...> вариант мультилокусного типирования, основанный на изучении структуры 9 генов V. cholerae – dnaE, lap, recA <...> Наибольшей гетерогенностью структуры характеризуются гены recA, pgm и cat, насчитывающие по 10 аллельных <...> нуклеотидной последовательности девяти генов, в том числе 7 генов «домашнего хозяйства»: dnaE, lap, recA <...> Для генов recA, chi, gmd, gyrB использовали температуру отжига праймеров 58°С.

20

ПОЛУЧЕНИЕ И СВОЙСТВА ВАКЦИННОГО ШТАММА ТУЛЯРЕМИЙНОГО МИКРОБА БЕЗ ОДНОЙ КОПИИ ГЕНА IGLC И БЕЗ ГЕНА RECA [Электронный ресурс] / Мокриевич [и др.] // Молекулярная генетика, микробиология и вирусология .— 2015 .— №3 .— С. 35-41 .— Режим доступа: https://rucont.ru/efd/399098

Автор: Мокриевич

Используемая в России для профилактики туляремии живая вакцина на основе штамма Francisella tularensis subsp. holarctica 15 линии НИИЭГ является высокоэффективной, однако проявляет определенную реактогенность и нестабильность. Поэтому разработка стабильной живой туляремийной вакцины с минимальным побочным действием остается актуальной проблемой. Методом аллельного обмена в вакцинном штамме F. tularensis проведено удаление одной копии гена iglC, продукт которого необходим для внутриклеточного размножения вакцинного штамма, и гена recA, играющего ключевую роль при гомологичной рекомбинации. Для замены интактных участков хромосомы F. tularensis на модифицированные сконструировали суицидный вектор pGM5 на основе бирепликонной плазмиды pHV33. Модифицированные фрагменты хромосомы содержали участок ДНК F. tularensis без структурной части гена iglC размером 545 п.о. (в плазмиде pGM∆iglC) и участок ДНК без структурной части гена recA размером 1060 п.о. (в плазмиде pGM∆recA) соответственно. По сравнению с вакцинным штаммом 15 сконструированный мутант 15/23-1ΔrecA размножался в макрофагоподобных клетках линии J774A.1 в 8-10 раз медленнее. Мыши линии BALB/c на иммунизацию штаммом 15/23-1ΔrecA реагировали меньшим снижением веса (~ 2 %), чем на штамм 15 (~ 14 %). Бактерии штамма 15/23-1ΔrecA практически не высевались из селезенок мышей BALB/c через 14 сут после заражения, в то время как бактерии штамма 15 обнаруживали в органах и на 21-е сутки. Штамм F. tularensis 15/23-1ΔrecA, обладающий сниженной реактогенностью, можно использовать в качестве основы для создания стабильной и безопасной живой туляремийной вакцины.

(в плазмиде pGM∆recA) соответственно. <...> Ключевыми генами системы рекомбинации бактерий являются гены recA и recD [15, 16]. <...> Конструирование плазмиды для мутагенеза гена recA. <...> Аллельный обмен гена recA. <...> ДНК F. tularensis делецией в гене recA размером 1060 п.о.

21

№3 [Сельскохозяйственная биология, 2007]

Журнал «Сельскохозяйственная биология» основан в 1966 году как научно-теоретическое издание в группе специализированных СМИ, но ведет историю с 1931 года. С 1946 до 1966 год он выходил под названием «Агробиология». С 1992 года учредителем журнала стала Российская академия сельскохозяйственных наук (РАСХН). Включен в Перечень ведущих рецензируемых научных журналов и изданий в Российской Федерации, в которых должны быть опубликованы основные результаты диссертаций на соискание ученой степени доктора и кандидата наук (Перечень ВАК) (по агрономии и лесному хозяйству, по зоотехническим и ветеринарным специальностям, а с 2007 года — также по биологическим наукам). «Сельскохозяйственная биология» — единственное российское научно-теоретическое издание, полностью посвященное классическим и современным направлениям биологии и селекции сельскохозяйственных растений, животных, микроорганизмов. Журнал отражает состояние исследований, проводимых в институтах и научных центрах РАСХН, РАН, университетах, публикует результаты совместных работ отечественных и зарубежных ученых. В журнале публикуются обзорные, проблемные, экспериментальные статьи. Динамичное развитие и высокий уровень публикаций определяют интерес к изданию и его признание в научной среде. Читатели журнала — ученые не только из России и стран СНГ, но и из США, Канады, Бразилии, Великобритании, Германии, Испании, Китая, Швейцарии, Швеции, Израиля, Японии и т.д. В 2011 году ежемесячно число уникальных посетителей сайта журнала (примерно 30 % из них иностранные) составляло более 2000, просмотров страниц — более 5000. С 1989 года журнал выходит двумя сериями: «Биология растений» (№№ 1, 3 и 5 – февраль, июнь и октябрь) «Биология животных» (№№ 2, 4 и 6 – апрель, август и декабрь).

Ïîëó÷åíèå ïëàçìèä äëÿ ýêñïðåññèè â êëåòêàõ ðàñòåíèé p35S-recA, p35S-recA-licBM3, p35S-NLS-recA è p35S-NLS-recA-licBM3 <...> , p35S-NLS-recA è p35SNLS-recA-licBM3. <...> Ïðåæäå ÷åì èñïîëüçîâàòü êëîíèðîâàííûå ãåíû (recA, recA-licBM3, NLS-recA è NLS-recA-licBM3) íåïîñðåäñòâåííî <...> ; 3 NLS-RecA; 4 — RecA-LicBM3; 5 — NLS-RecALicBM3; 6 — êîíòðîëü; 7 — RecA-LicBM3; 8 — NLS-RecA-LicBM3 <...> p35S-recA-licBM3: 35S CaMV recA licBM3 pA p35S-NLS-recA: NLS 35S CaMV recA pA p35SNLS-recA-licBM3: NLS

Предпросмотр: Сельскохозяйственная биология №3 2007.pdf (0,5 Мб)
22

ИММУНОБИОЛОГИЧЕСКИЕ СВОЙСТВА ВАКЦИННОГО ШТАММА FRANCISELLA TULARENSIS С ДЕЛЕТИРОВАННЫМ ГЕНОМ recA [Электронный ресурс] / Павлов [и др.] // Инфекция и иммунитет .— 2013 .— №2 .— С. 64-65 .— Режим доступа: https://rucont.ru/efd/442649

Автор: Павлов

Для профилактики туляремии в РФ используется живая вакцина, созданная на основе штамма F. tularensis 15. Анализ нуклеотидной последовательности генома штамма F. tularensis LVS, производного штамма F. tularensis 15, показал наличие recAподобного гена. Известно, что инактивация белка RecA в туберкулезном вакцинном штамме BCG приводить к стабилизации его вакцинных свойств. В данной работе были изучены иммунобиологические свойства F. tularensis 15 с делетированным методом аллельного обмена recA-подобным геном.

ИММУНОБИОЛОГИЧЕСКИЕ СВОЙСТВА ВАКЦИННОГО ШТАММА FRANCISELLA TULARENSIS С ДЕЛЕТИРОВАННЫМ ГЕНОМ recA В.М <...> Известно, что инактивация белка RecA в туберкулезном вакцинном штамме BCG приводить к стабилизации его <...> Показано, что делеция recA гена приводит к репрессии механизма рекомбинации в туляремийном микробе. <...> Удаление гена recA из генома F. tularensis 15 привело к десятикратному снижению вирулентCopyright ОАО <...> УФ-облучению по сравнению с исходным штаммом F. tularensis 15, при этом введение плазмиды pHV33-mob/recA

23

ПОЛУЧЕНИЕ МУТАНТОВ, ПОДБОР СИСТЕМ ГЕНЕТИЧЕСКОГО ПЕРЕНОСА И КЛОНИРОВАНИЕ НЕКОТОРЫХ ГЕНОВ МЕТАНОКИСЛЯЩИХ БАКТЕРИЙ АВТОРЕФЕРАТ ДИС. ... КАНДИДАТА БИОЛОГИЧЕСКИХ НАУК

Автор: СТОЛЯР СЕРГЕЙ МАРКОВИЧ
ОРДЕНА ЛЕНИНА И ОРДЕНА ДРУЖБЫ НАРОДОВ АКАДЕМИЯ НАУК УКРАИНСКОЙ ССР

Целью данной работы было изучение генетической изменчивости метанотрофов, действия на них ряда мутагенов, систем генетической рекомбинации и обмена генов, а также возможности клонирования генов в гетерологичных хозяевах.

Escherichia coli : J53 proB22 metF63» C600 trh-I leuB6 tonAIlacYI supE44 rfbDI thi-I; C600 srli» TnIO recA56 <...> ; HBIOI leuB6 pro-22 thi-I lacYI recAI3 end-IyrpsH hsdR hsdM; REI (HBIOI) recA+ hisjsTnIO; AB2463. argE3 <...> Зависимость вы­ живаемости Б. coli C600 recA+ (I), Е.сЪИ C600 гвоА" (2), М.rubra (3) И М. thermophilus <...> Клонирование и характеристика recA-подобного гена M.thenaop b i l u s . <...> Cloning of Methylococcus theraophllus recA'like gene in E.coli // Abs. 6th Int.

Предпросмотр: ПОЛУЧЕНИЕ МУТАНТОВ, ПОДБОР СИСТЕМ ГЕНЕТИЧЕСКОГО ПЕРЕНОСА И КЛОНИРОВАНИЕ НЕКОТОРЫХ ГЕНОВ МЕТАНОКИСЛЯЩИХ БАКТЕРИЙ.pdf (0,0 Мб)
24

ВИРУСОЛОГИЧЕСКИЕ ОСОБЕННОСТИ ЭПИЗООТИЧЕСКОГО ПРОЦЕССА БЕШЕНСТВА В ЛИПЕЦКОЙ ОБЛАСТИ [Электронный ресурс] / Очкасова [и др.] // Инфекция и иммунитет .— 2013 .— №2 .— С. 64-64 .— Режим доступа: https://rucont.ru/efd/442648

Автор: Очкасова

Активность Среднерусского природноочагового региона бешенства определяет особенности эпизоотического процесса в Центральном и Центрально-Черноземном регионах. В 2007–2011 гг. Липецкая область, наряду с Белгородской и Московской областями, являлась самой неблагополучной по бешенству животных в стране (5,7 случаев на 1000 км2) В области выявлена средняя степень корреляционной связи между заболеваемостью животных бешенством и численностью лисицы (r = 0,55; p < 0,05). При выявлении взаимозависимости течения эпизоотического процесса бешенства на всех приграничных территориях была установлена высокая достоверная степень корреляционной зависимости (r = 0,65–0,9; p < 0,05).

ИММУНОБИОЛОГИЧЕСКИЕ СВОЙСТВА ВАКЦИННОГО ШТАММА FRANCISELLA TULARENSIS С ДЕЛЕТИРОВАННЫМ ГЕНОМ recA В.М <...> Известно, что инактивация белка RecA в туберкулезном вакцинном штамме BCG приводить к стабилизации его <...> были изучены иммунобиологические свойства F. tularensis 15 с делетированным методом аллельного обмена recA-подобным <...> Показано, что делеция recA гена приводит к репрессии механизма рекомбинации в туляремийном микробе. <...> Удаление гена recA из генома F. tularensis 15 привело к десятикратному снижению вирулентCopyright ОАО

25

ИЗУЧЕНИЕ РАСПРОСТРАНЕННОСТИ ИНФЕКЦИЙ, ПРОТЕКАЮЩИХ С TORCH-СИНДРОМОМ, У НОВОРОЖДЕННЫХ АКУШЕРСКОГО СТАЦИОНАРА [Электронный ресурс] / Осьмирко, Лялина // Инфекция и иммунитет .— 2013 .— №2 .— С. 63-64 .— Режим доступа: https://rucont.ru/efd/442647

Автор: Осьмирко

В последние годы в структуре репродуктивных потерь (перинатальная смертность, невынашивание беременности) значительно возросла роль внутриутробных инфекций. В связи с этим проблема профилактики заболеваний, прoтекающих с TORCHсиндромом, у новорожденных приобретает особое значение, поскольку указанные инфекции нередко являются причиной формирования грубых нарушений развития плода, преждевременных родов и смерти недоношенных детей в раннем неонатальном периоде.

ИММУНОБИОЛОГИЧЕСКИЕ СВОЙСТВА ВАКЦИННОГО ШТАММА FRANCISELLA TULARENSIS С ДЕЛЕТИРОВАННЫМ ГЕНОМ recA В.М <...> Известно, что инактивация белка RecA в туберкулезном вакцинном штамме BCG приводить к стабилизации его <...> были изучены иммунобиологические свойства F. tularensis 15 с делетированным методом аллельного обмена recA-подобным <...> Показано, что делеция recA гена приводит к репрессии механизма рекомбинации в туляремийном микробе. <...> Удаление гена recA из генома F. tularensis 15 привело к десятикратному снижению вирулентCopyright ОАО

26

Генетика бактерий в вопросах и ответах учеб. пособие

Автор: Давыдова О. К.
ОГУ

Учебное пособие представляет собой систематизированное изложение генетики микроорганизмов в форме вопросов и ответов, что соответствует пунктам профессиональной компетентности ПК-4 и ПК-6 федерального образовательного стандарта высшего образования по направлению подготовки 06.03.01 Биология. В учебном пособии представлены общие сведения о принципах организации и механизмах реализации генетической информации прокариот, рассмотрены современные представления в областях репликации, рестрикции и модификации, рекомбинации и репарации генетического материала, транскрипции генов, а также способах обмена генетической информацией у микроорганизмов.

title=RecA&action=edit&redlink=1 131 5 Молекулярные механизмы рекомбинации 5.1 Что такое генетическая <...> С однонитевой ДНК RecA белок связывается гораздо эффективнее, чем с двунитевой. <...> RecA-АТФ-оцДНК, который образуется при полимеризации протомеров RecA на оцДНК в присутствии АТФ. <...> Филамент RecA-АТФ-оцДНК имеет спиральную структуру и способен втягивать внутрь своей спирали молекулы <...> Рисунок 48 –Участие RecA-белка в формировании филамента Как видно, небольшой по размеру белок RecA

Предпросмотр: Генетика бактерий в вопросах и ответах.pdf (0,9 Мб)
27

ИНТЕГРАТИВНЫЕ КОНЪЮГАТИВНЫЕ ЭЛЕМЕНТЫ МИКРООРГАНИЗМОВ (ICEs) [Электронный ресурс] / Захарова, Викторов // Молекулярная генетика, микробиология и вирусология .— 2015 .— №3 .— С. 11-18 .— Режим доступа: https://rucont.ru/efd/399094

Автор: Захарова

Интегративные конъюгативные элементы (ICEs) – обширная группа мобильных генетических элементов, обнаруженных у грамположительных и грамотрицательных бактерий. Данные генетические элементы реплицируются, находясь в интегрированном в хромосому хозяина состоянии, однако сохраняют способность к вырезанию из хромосомы и конъюгативному переносу. Имея набор генов систем конъюгативного переноса, контроля удаления и интеграции в хромосому, ICEs непосредственно участвуют в процессах горизонтального переноса генетических детерминант, увеличивающих адаптивный потенциал бактериальных видов, а также выступают в качестве мобилизующего фактора для других генетических элементов.

Передача sXt требует наличия гена recA в донорских клетках, но молекулярные основы данного обстоятельства <...> После повреждения ДНК и индукции sosответа ко-протеазная активность recA стимулирует аутопротеолиз Ci <...> Ко-протеазная активность белка recA активируется во время sos-ответа. <...> Активированный recA (recA*) вызывает аутораспад SetR, репрессию s086, экспрессию setD и setC. <...> несколько генов, таких как eexS, который является регулятором передачи, экспрессируются конститутивно. recA-зависимый

28

МИТОХОНДРИАЛЬНЫЕ ЦИТОПАТИИ: ПРИЧИНЫ ВОЗНИКНОВЕНИЯ И ПУТИ КОРРЕКЦИИ [Электронный ресурс] / Дерябина, Исакова // Биологические мембраны: Журнал мембранной и клеточной биологии .— 2017 .— №2 .— С. 17-34 .— Режим доступа: https://rucont.ru/efd/589765

Автор: Дерябина

Митохондриальные цитопатии – гетерогенная группа системных расстройств, обусловленных мутациями митохондриального или ядерного генома. В обзоре представлены данные о патогенных мутациях митохондриальной ДНК, приводящих к нарушениию процессов окислительного фосфорилирования и энергетического обмена в клетках и возникновению митохондриальных цитопатий. Рассмотрены пути медикаментозной коррекции митохондриальных цитопатий, направленной на достижение оптимальной энергетической эффективности митохондрий с нарушенной функцией и повышение энергетического обмена в тканях, а также на предупреждение повреждения митохондриальных мембран свободными радикалами с помощью антиоксидантов и мембранопротекторов. Сделан вывод о неэффективности используемых в настоящее время стратегий и о необходимости разработки нового подхода, которым может стать генная терапия митохондриальных болезней. Проанализированы существующие методы коррекции дефектов генов, способные восстановить или заменить дефектный ген, экспрессировать полноценный генный продукт или блокировать работу мутантных и чужеродных генов. Описанные подходы к генотерапии митохондриальных болезней человека требуют введения в ядерный или митохондриальный геном живого человека чужеродных последовательностей, что может привести к непредсказуемым последствиям. Перспективным может стать создание системы гомологичной рекомбинации на основе экстремофильных дрожжей Yarrowia lipolytica, которая позволяет корректировать и поддерживать полноразмерную нативную мтДНК человека в клетках этих дрожжей. Фенотипическая селекция в сочетании с искусственно приданной митохондриям дрожжей Y. lipolytica способности к гомологичной рекомбинации позволяет реплицировать в них интактную митохондриальную ДНК человека и устранять патогенные мутации с использованием стандартной процедуры сайт-направленного ПЦР-мутагенеза, разработанной для бактерий. Копии митохондриальной ДНК индивидуального пациента, исправленные в клетках Y. lipolytica, могут быть возвращены в организм путем трансфекции поддерживаемых в культуре мезенхимальных стромальных клеток, отобранных на обедненных средах, где преимущество получают клетки с высокой дыхательной активностью митохондрий.

Основываясь на этом факте, на базе типового штамма Y. lipolytica W29 создан продуцент рекомбиназы RecA <...> Поступление рекомбинантного белка RecA в митохондрии обеспечивалось за счет некодирующих областей 3'- <...> Схема функциональных элементов конструкции pQ-SRUS, предназначенной для введения белка RecA в клетки <...> Этот штамм Y. lipolytica W29, несущий ген рекомбиназы RecA в составе интегративной конструкCopyright <...> устойчивости к гигромицину по принципу двуплечевой гомологичной рекомбинации с использованием белка RecA

29

ВЛИЯНИЕ ДЕЛЕЦИИ ПРОФАГА CTXϕ ВОЗБУДИТЕЛЯ ХОЛЕРЫ НА ЭКСПРЕССИЮ РЕГУЛЯТОРНЫХ ГЕНОВ, КОНТРОЛИРУЮЩИХ ВИРУЛЕНТНОСТЬ И ОБРАЗОВАНИЕ БИОПЛЕНКИ [Электронный ресурс] / Агафонов [и др.] // Генетика .— 2017 .— №3 .— С. 26-39 .— Режим доступа: https://rucont.ru/efd/590181

Автор: Агафонов

Представлены результаты сравнительного анализа нуклеотидной последовательности хромосомного участка, содержащего профаг CTXϕ, изогенных токсигенных (Tox+) и нетоксигенных (Tox–) штаммов Vibrio cholerae биовара Эль Тор. Показано, что спонтанные мутанты, имеющие идентичный фенотип Tox–, образуются в результате как точного исключения профага CTXϕ из хромосомы (размер делеции 6.9 тпн), так и неточного вырезания, выражающегося в дополнительной потере двух других профагов (RS1ϕ и TLCϕ), примыкающих к CTXϕ (размер делеции 17.4 тпн). Обнаружено, что делеция профага CTXϕ приводит к одновременному изменению у нетоксигенных мутантов нескольких фенотипических свойств, связанных с вирулентностью или образованием биопленки: колонизирующей способности, продукции HA/P, VPS и подвижности. Впервые установлено, что причиной плейотропного эффекта делеции CTXϕ является каскадное снижение уровня транскрипции семи изученных регуляторных генов (toxR, aphA, tcpP, tcpH, toxT; vspT, vspR), контролирующих вирулентность и процессы формирования биопленки у возбудителя холеры.

Нормирование полученных данных проводили относительно конститутивно экспрессирующегося гена recA методом <...> GAGGATCACACTAGACGGGTA Рассчитаны авторами rtxA-1 rtxA-2 CACTCATTCCGATAACCAC GCGATTCTCAAAGAGATGC [5] recA-RT1 <...> recA-RT2 recA-зонд ACGGGTAACCTCAAGCAATC TATCCAAACGAACAGAAGCG (FAM)CCACTGGCGGTAACGCACTGA-(BHQ1) Рассчитаны

30

Подавление роста штаммов золотистого стафилококка светом низкоинтенсивного красного лазера [Электронный ресурс] / Брилль [и др.] // Лазерная медицина .— 2016 .— №2 .— С. 56-58 .— Режим доступа: https://rucont.ru/efd/467844

Автор: Брилль

Целью настоящей работы явилось изучение принципиальной возможности подавления роста различных штаммов золотистого стафилококка светом низкоинтенсивного красного лазера с длиной волны 660 нм. В качестве объекта исследования использовались клетки метициллин-чувствительного и метициллин-резистентного штаммов золотистого стафилококка. Для облучения применялся полупроводниковый лазер, генерирующий линейно-поляризованное излучение красной области спектра (λ – 660 нм). Плотность мощности составляла 100 мВт/см2, время облучения – 5, 10, 15 и 30 мин, энергетическая экспозиция – соответственно 30, 60, 90 и 180 Дж/см2. Установлено, что низкоинтенсивное лазерное излучение оказывает ингибирующее влияние на рост колоний как метициллин-чувствительного, так и метициллин-резистентного штаммов золотистого стафилококка, причем резистентный штамм обладает более высокой чувствительностью к действию красного света, поскольку бактериостатический эффект выявляется при действии более низких доз облучения.

фоточувствительность стафилокков зависит от состояния внутриклеточной ДНК-репарирующей системы, включающей RecA-белок <...> Отсутствие RecA увеличивает повреждение ДНК, приводящее к гибели микробной клетки. <...> Fine-tuning recA expression in Staphylococcus aureus for antimicrobial photoinactivation: importance

31

СРАВНИТЕЛЬНЫЙ АНАЛИЗ МЕТАБОЛИЗМА ГЛЮКОЗЫ В ШТАММАХ VIBRIO CHOLERAE БИОВАРА ЭЛЬ ТОР [Электронный ресурс] / Заднова [и др.] // Молекулярная генетика, микробиология и вирусология .— 2017 .— №2 .— С. 26-31 .— Режим доступа: https://rucont.ru/efd/620140

Автор: Заднова

Проведен сравнительный анализ ферментации глюкозы у типичных штаммов V. cholerae биовара Эль Тор, выделенных в Российской Федерации в 1970–1990 гг., и высоко вирулентных штаммов геновариантов, завезенных в 1993–2012 гг. Показано, что у геновариантов V. cholerae биовара Эль Тор с приобретением профага СТХ классического типа (или только его гена ctxB) и повышением вирулентности изменился метаболизм глюкозы, что фенотипически выражается в отсутствии роста на минимальной среде с добавлением 1 % углевода и сниженной способности к его ферментации до ацетоина в реакции Фогеса–Проскауэра. Возможные причины сниженного метаболизма глюкозы связаны с присутствием SNP в гене alsD, кодирующем фермент ацетолактат декарбоксилазу и входящим в als оперон, участвующим в образовании ацетоина, а также с увеличенной экспрессией регуляторного белка АphA, контролирующего биосинтез ацетоина. Ключевые слова: Vibrio cholerae; геноварианты; метаболизм глюкозы; образование ацетоина; экспрессия генов.

В качестве референсного гена был использован recA (праймеры recA-F/r ACGGGtAACCtCAAGCAAtC/tAtCCAAACGAACAGAAGCG <...> ; зонд recA-F/r – (FAM) CCACtGGCGGtAACGCACtGA-(BhQ1).

32

ИСПОЛЬЗОВАНИЕ ТЕХНОЛОГИИ MALDI-TOF/MS ДЛЯ ИДЕНТИФИКАЦИИ МИКРООРГАНИЗМОВ ИЗ ВНЕШНЕЙ СРЕДЫ АНТАРКТИДЫ [Электронный ресурс] / Панин, Наумик // Инфекция и иммунитет .— 2013 .— №2 .— С. 65-65 .— Режим доступа: https://rucont.ru/efd/442650

Автор: Панин

Изучение микробиоты во внешней среде на территориях размещения объектов Советской и Российской антарктической экспедиции (РАЭ) продолжается более 50 лет. Однако до настоящего времени нет достаточной информации о микробных сообществах, характерных для этого региона. Объективными причинами таких фрагментарных сведений являются трудности культивирования многочисленных видов микроорганизмов в отрыве от стационарных лабораторий.

УФ-облучению по сравнению с исходным штаммом F. tularensis 15, при этом введение плазмиды pHV33-mob/recA <...> с геном recA в клетки F. tularensis 15/10ΔrecA полностью восстанавливает устойчивость бактерий к УФ-облучению

33

№11 [Клиническая лабораторная диагностика, 2013]

Основан в 1955 г. Главный редактор – Титов Владимир Николаевич, доктор медицинских наук, профессор, заведующий лабораторией клинической биохимии липидного обмена ФБУН «Российский кардиологический научно-производственный комплекс» Минздрава России. Журнал издается как ежемесячное профессиональное научно-практическое издание с 1955 г. (до 1992 г. под названием «Лабораторное дело»). На протяжении многих лет журнал был основным источником научной и практической информации для сотрудников клинико-диагностических лабораторий и играл роль стимула совершенствования лабораторного обеспечения медицинской помощи. Журнал публикует научные и практические материалы, подготовленные сотрудниками научных, образовательных и лечебных учреждений России и зарубежных стран: оригинальные статьи, обзоры литературы, лекции видных специалистов разных дисциплин лабораторной медицины, описания сложных клинико-диагностических случаев заболеваний, информации о научно-практических мероприятиях, дискуссии между сторонниками разных подходов к решению актуальных проблем, ответы ученых и организаторов здравоохранения на насущные вопросы практиков лабораторного дела. Осуществляет публикацию переводов статей зарубежных авторов, представляющих наибольший научно-практический интерес для специалистов в нашей стране и опубликованных в профессиональной научной литературе за рубежом(в частности, в журнале «Clinical Chemistry», с которым заключено соответствующее соглашение).

Оценка продуктов амплификации генов recA, gltB позволяет дифференцировать Bcc и Achromobacter sp. <...> ПЦР проводили для 4 мишеней: recA, gltB, gyrB, 16S rDNA, используя праймеры, представленные в табл. 1 <...> Модифицированная нами программа амплификации одинакова для мишеней recA, gltB, gyrB: 950С – 10 мин, ( <...> Как видно из табл. 2, аллели recA и gltB у всех образцов с буркхолдериями были одинаковыми. <...> Последующий анализ, предполагающий амплификацию и секвенирование фрагментов генов recA, gltB и gyrB,

Предпросмотр: Клиническая лабораторная диагностика №11 2013.pdf (17,6 Мб)
34

ОЦЕНКА ЭФФЕКТИВНОСТИ МОЛЕКУЛЯРНОГО ТИПИРОВАНИЯ ЭПИДЕМИЧЕСКИ ОПАСНЫХ ШТАММОВ VIBRIO СHOLERAE ELTOR НА ОСНОВАНИИ АНАЛИЗА СТРУКТУРЫ «HOUSEKEEPING» ГЕНОВ [Электронный ресурс] / Миронова [и др.] // Инфекция и иммунитет .— 2013 .— №2 .— С. 58-58 .— Режим доступа: https://rucont.ru/efd/442634

Автор: Миронова

Мультилокусноесиквенс-типирование(MLST)— один из методов молекулярного типирования микроорганизмов, позволяющий выявлять генетические взаимосвязи между штаммами на основании сопоставления нуклеотидных последовательностей генов «домашнего хозяйства» («housekeeping» генов). Цель работы — анализ структуры комплекса «housekeeping» генов эпидемически опасных штаммов V. cholerae eltor, изолированных при осложнениях по холере в Сибири и на Дальнем Востоке.

2003 г. схеме, предусматривающей определение структуры восьми генов «домашнего хозяйства» — dnaE, lap, recA <...> В геноме V. cholerae cholerae 569В выявлены нуклеотидные замены в генах recA, cat, chi, rstA, при этом

35

НОВЫЙ ФАРМАКОЛОГИЧЕСКИЙ АСПЕКТ РАСПРОСТРАНЕНИЯ БАКТЕРИЙ, РЕЗИСТЕНТНЫХ К ХИМИОТЕРАПЕВТИЧЕСКИМ ПРЕПАРАТАМ [Электронный ресурс] / Мирошниченко [и др.] // Инфекция и иммунитет .— 2013 .— №2 .— С. 58-59 .— Режим доступа: https://rucont.ru/efd/442635

Автор: Мирошниченко

Проблема распространения штаммов, резистентных к антибактериальной терапии, с течением времени приобретает все более угрожающий характер. Основным фактором, обусловливающим это явление, считается бесконтрольное, нерациональное применение химиотерапевтических средств. Однако лечение больных с инфекционным заболеванием, как правило, включает и другие фармакологические вещества, которые потенциально могут изменять активность антибактериальных средств и способствовать реализации бактериями механизмов резистентности.

2003 г. схеме, предусматривающей определение структуры восьми генов «домашнего хозяйства» — dnaE, lap, recA <...> В геноме V. cholerae cholerae 569В выявлены нуклеотидные замены в генах recA, cat, chi, rstA, при этом

36

№2 [Молекулярная генетика, микробиология и вирусология, 2015]

Основан в 1983 г. Главный редактор журнала - Костров Сергей Викторович - член-корреспондент РАН, профессор, доктор биологических наук, директор Института молекулярной генетики РАН. Журнал освещает наиболее актуальные теоретические и прикладные проблемы молекулярной генетики про- и эукариотных организмов, молекулярной микробиологии и молекулярной вирусологии. Важную роль журнал отводит исследованиям генетического аппарата микроорганизмов, изысканиям форм генетического обмена, генетического картирования патогенных возбудителей, выяснению строения и функций внехромосомных факторов наследственности и мигрирующих генетических элементов, теоретическим исследованиям механизмов генетической регуляции. Публикует результаты исследований молекулярных и генетических основ эукариотной клетки, функционирования хромосом и хроматина, природы генетических изменений при злокачественном перерождении и ряде наследственных заболеваний. На страницах журнала освещается разработка молекулярных основ вирусологии, в том числе вопросы интеграции вирусных и клеточных геномов, вопросы персистенции.

Иркутск Проведено исследование аллельного полиморфизма генов «домашнего хозяйства» (dnaE, lap, recA, <...> Наибольшей гетерогенностью структуры характеризуются гены recA, pgm и cat, насчитывающие по 10 аллельных <...> нуклеотидной последовательности девяти генов, в том числе 7 генов «домашнего хозяйства»: dnaE, lap, recA <...> Для генов recA, chi, gmd, gyrB использовали температуру отжига праймеров 58°С. <...> штаммы нетоксигенные штаммы dnaE 1194 T C gyrB 705 A G 813 T C 966 A T 972 T A 1170 G T pgm 849 T C recA

Предпросмотр: Молекулярная генетика, микробиология и вирусология №2 2015.pdf (5,5 Мб)
37

ОСОБЕННОСТИ ЛЕЧЕНИЯ ПАЦИЕНТА С МУКОВИСЦИДОЗОМ ПРИ СМЕШАННОМ МИКРОБНОМ ИНФИЦИРОВАНИИ ОРГАНОВ ДЫХАНИЯ, В ТОМ ЧИСЛЕ PANDORAEA PNOMENUSA [Электронный ресурс] / Симонова [и др.] // Российский педиатрический журнал .— 2016 .— №2 .— С. 51-60 .— Режим доступа: https://rucont.ru/efd/389480

Автор: Симонова

Инфекция дыхательных путей — главная причина осложнений и смерти больных муковисцидозом (МВ). Особые опасения вызывают трансмиссивные штаммы грамотрицательных неферментирующих бактерий порядка Burkholderiales: Burkholderia cepacia complex, Achromobacter spp., Pandoraea spp. В статье впервые представлен клинический случай смешанного микробного инфицирования пациента с МВ с участием Pandoraea pnomenusa. Изложены особенности диагностики и лечения больного на протяжении 20 лет, описаны данные обследования пациента и микробиоты его дыхательных путей. Показано, что своевременная идентификация P. pnomenusa с помощью масс-спектрометрии MALDI-TOF и молекулярно-генетических методов способствовала изоляции пациента в стационаре, переводу его на стационарозамещающую терапию, что предотвратило кросс-инфицирование других больных МВ. Постоянный микробиологический контроль выявил нарастание антибиотикорезистентности P. pnomenusa.

Для идентификации представителей порядка Burkholderiales использовали гены gltb, gyrb, recA, проводя <...> дальнейшей характеристики P. pnomenusa использовали мишени MLST Bcc: gltb — ген глутамат синтазы и recA <...> — ген рекомбиназы reca. <...> По фрагменту гена recA P. pnomenusa пациента С. была сходна на 100% с представленными в GenBank штаммами

38

ОПРЕДЕЛЕНИЕ ОДНОНУКЛЕОТИДНЫХ ГЕНЕТИЧЕСКИХ ПОЛИМОРФИЗМОВ С ПОМОЩЬЮ ПИРОСЕКВЕНИРОВАНИЯ [Электронный ресурс] / Миронов [и др.] // Инфекция и иммунитет .— 2013 .— №2 .— С. 57-58 .— Режим доступа: https://rucont.ru/efd/442633

Автор: Миронов

На сегодняшний день известно значительное количество однонуклеотидных полиморфизмов (SNP), для которых показана связь с развитием патологических состояний. Генетический анализ SNP может быть использован в клинической практике для выявления лиц, имеющих предрасположенность к тому или иному заболеванию, что может иметь значение при планировании и проведении профилактических мероприятий или выбора оптимальных схем терапии, учитывающих индивидуальные особенности.

2003 г. схеме, предусматривающей определение структуры восьми генов «домашнего хозяйства» — dnaE, lap, recA <...> В геноме V. cholerae cholerae 569В выявлены нуклеотидные замены в генах recA, cat, chi, rstA, при этом

39

Основы биохимии Ленинджера. В 3 т. Т. 3. Пути передачи информации [учебник], Lehninger Principles of Biochemistry

Автор: Нельсон Дэвид
М.: Лаборатория знаний

В книге, написанной американскими учеными, которые получили признание как талантливые преподаватели университетского уровня, рассмотрены современные концепции биохимии в соответствии с изменившейся идеологией этой науки. В настоящее издание внесены исправления, уточняющие перевод. В том 3 вошла часть III «Пути передачи информации», ответы на вопросы, решения задач и предметно-именной указатель по материалу томов 1–3, а также принятые сокращения и словарь терминов. Обсуждаются основная догма молекулярной биологии и ее современное понимание, процессы передачи и хранения генетической информации как у бактерий, так и у эукариот (репликация, транскрипция, трансляция, репарация и рекомбинация), строение хромосом, механизмы ферментативных процессов, функции различных РНК в клетке, рибозимы, сплайсинг, альтернативный сплайсинг, процессинг. Подробно описан биосинтез белка, его транспортировка к месту использования и дальнейшее разрушение, регуляция экспрессии генов. В каждой главе (как в томах 1 и 2) приведены примеры из медицины, молекулярной биологии и смежных областей, а также интересные задания и вопросы.

Белок RecA. а — нуклеопротеиновый комплекс белка RecA с одноцепочечной ДНК (электронная микрофотография <...> Белок RecX ингибирует удлинение нитей RecA. Белок DinI стабилизирует RecA, предотвращая разборку. <...> RecA. <...> Белок RecX ингибирует удлинение нитей RecA. Белок DinI стабилизирует RecA, предотвращая разборку. <...> RecA.

Предпросмотр: Основы биохимии Ленинджера. В 3 т. Т. 3. Пути передачи информации.pdf (0,4 Мб)
40

ВЫЯВЛЕНИЕ БАКТЕРИАЛЬНЫХ ПАТОГЕНОВ В КЛЕЩАХ DERMACENTOR SP. НА ТЕРРИТОРИИ УЛЬЯНОВСКОЙ ОБЛАСТИ [Электронный ресурс] / Панферова [и др.] // Инфекция и иммунитет .— 2013 .— №2 .— С. 65-66 .— Режим доступа: https://rucont.ru/efd/442651

Автор: Панферова

На территории Ульяновской области расположены очаги нескольких природно-очаговых инфекций, включая лихорадку Ку и иксодовый клещевой боррелиоз (ИКБ), которые представляют наиболее актуальные проблемы в краевой инфекционной патологии. Специфическими переносчиками боррелий (возбудители ИКБ) являются иксодовые клещи, которые также участвуют в циркуляции коксиелл и других патогенов в природных очагах. Расширение ареала инфицированных клещей в значительной мере обуславливает тенденцию роста заболеваемости и распространение природно-очаговых инфекций на новые территории. Целью данного исследования была оценка зараженности клещей рода Dermacentor sp. возбудителями коксиеллезной инфекции и боррелиоза.

УФ-облучению по сравнению с исходным штаммом F. tularensis 15, при этом введение плазмиды pHV33-mob/recA <...> с геном recA в клетки F. tularensis 15/10ΔrecA полностью восстанавливает устойчивость бактерий к УФ-облучению

41

№3 [Молекулярная генетика, микробиология и вирусология, 2012]

Основан в 1983 г. Главный редактор журнала - Костров Сергей Викторович - член-корреспондент РАН, профессор, доктор биологических наук, директор Института молекулярной генетики РАН. Журнал освещает наиболее актуальные теоретические и прикладные проблемы молекулярной генетики про- и эукариотных организмов, молекулярной микробиологии и молекулярной вирусологии. Важную роль журнал отводит исследованиям генетического аппарата микроорганизмов, изысканиям форм генетического обмена, генетического картирования патогенных возбудителей, выяснению строения и функций внехромосомных факторов наследственности и мигрирующих генетических элементов, теоретическим исследованиям механизмов генетической регуляции. Публикует результаты исследований молекулярных и генетических основ эукариотной клетки, функционирования хромосом и хроматина, природы генетических изменений при злокачественном перерождении и ряде наследственных заболеваний. На страницах журнала освещается разработка молекулярных основ вирусологии, в том числе вопросы интеграции вирусных и клеточных геномов, вопросы персистенции.

of PCR-amplified dsrB gene fragments has been described to follow population dynamics of SRB [45]. recA <...> gene The recA gene, which plays a central role in DNA recombination in many processes relevant to DNA <...> There are two types of recA gene libraries constructed, one with broad-specificity recA primers (BuR1 <...> other from the products of nested PCRs using Burkholderia-specific primers (BuR3 and BuR4) [47]. the reca <...> Besides, recA gene can also be used as a phylogenetic marker in the classification of Aeromonas strains

Предпросмотр: Молекулярная генетика, микробиология и вирусология №3 2012.pdf (2,6 Мб)
42

Клонирование и характеристика полигидроксибутиратсинтазы из Methylobacterium extorquens AM1 [Электронный ресурс] / Замахаева [и др.] // Журнал Сибирского федерального университета. Биология. Journal of Siberian Federal University/ Biology .— 2016 .— №2 .— С. 39-49 .— Режим доступа: https://rucont.ru/efd/446040

Автор: Замахаева

В результате поиска генов, кодирующих вероятные ПГБ-синтазы в геномах бактерий рода Methylobacterium, выявлены множественные (до пяти у одного штамма) гены ПГБсинтаз. Филогенетическим анализом показано, что белки PhaC1, PhaC2, PhaC3 относятся к I классу ПГБ-синтаз, белки PhaC4 – к ПГБ-синтазам III класса, тогда как PhaC5, повидимому, представляет неохарактеризованный класс ПГБ-синтаз. Впервые выделена и охарактеризована рекомбинантная ПГБ-синтаза I класса (КФ 2.3.1.B2) из Methylobacterium extorquens AM1, кодируемая геном phaC1. Молекулярная масса мономера фермента составила 78 кДа. Константа Михаэлиса (Km) для PhaC1 из штамма AM1 составила 1,3 мМ, а максимальная скорость реакции (Vmax) – 0,1 мкмоль·мин-1·мг-1. Получен делеционный мутант Methylobacterium extorquens по гену phaC, перспективный для дальнейшего исследования особенностей биосинтеза ПГБ метилобактериями.

использованные в работе Штамм/плазмида Генотип/ Характеристика Источник Escherichia coli S17-1 thi pro recA <...> Smr (Simon et al., 1983) E. coli TOP10 mcrA,Δ(mrr-hsdRMS-mcrBC), Phi80lacZ(del) M15, ΔlacX74, deoR, recA1

43

ЭВОЛЮЦИЯ НАПЕРЕГОНКИ, ИЛИ ПОЧЕМУ АНТИБИОТИКИ ПЕРЕСТАЮТ РАБОТАТЬ [Электронный ресурс] / Андреев // Химия и жизнь ХХI век .— 2014 .— №9 .— С. 22-25 .— Режим доступа: https://rucont.ru/efd/514097

Автор: Андреев

Слава и мировое признание в науке — штука капризная и непредсказуемая. Многие слышали историю об открытии Александером Флемингом первого из антибиотиков — пенициллина, в которой, казалось бы, пустяковая случайность сыграла ключевую роль. В 1928 году в чашку для культивации бактерий, забытую на столе в его лаборатории, случайно попал плесневый гриб рода Penicillium, и Флеминг обратил внимание, что колонии микроба гибнут (лизируются) рядом с бляшкой плесени (рис. 1).

Контролируют SOS-систему два белка — RecA и LexA. <...> Связавшись с ней, RecA образует что-то вроде длинной нити (филамента), которая заставляет репрессор отсоединиться

44

№2 [Молекулярная биология, 2018]

Основан в 1966 г. Освещает проблемы молекулярной, клеточной и компьютерной биологии, включая структурную и функциональную геномику, транскриптомику, протеомику, биоинформатику, биомедицину, молекулярную энзимологию, молекулярную вирусологию и иммунологию, теоретические основы биотехнологии, физику и физическую химию белков и нуклеиновых кислот, касается проблем молекулярной эволюции.Входит в Перечень ВАК

(на пероксид водорода), pSoxS-lux (на супероксидный анион-радикал) и pColD-lux (на повреждения ДНК). <...> ), MG1655 (pKatG-lux), MG1655 (pColD-lux), содержащих плазмиды с опероном luxCDABE фотобактерии Photorhabdus <...> K.N., Muniyappa K. (2014) Suramin is a potent and selective inhibitor of Mycobacterium tuberculosis RecA <...> protein and the SOS response: RecA as a potential target for antibacterial drug discovery. <...> pColD-lux (detects DNA damage).

Предпросмотр: Молекулярная биология №2 2018.pdf (0,1 Мб)
45

Гены по Льюину, Lewin’s Genes

Автор: Кребс Дж.
М.: Лаборатория знаний

Перевод десятого англоязычного издания книги, ставшей классикой для молекулярных биологов всего мира, содержит последние достижения в области молекулярной биологии и молекулярной генетики, включая структуру генов, последовательности, организацию и экспрессию. Издание дополнено новыми разделами, хорошо иллюстрировано и структурировано, что помогает студентам лучше ориентироваться в отдельных темах.

Этот этап катализирует RecA. <...> у мутантов recA: неспособностью RecA к обмену цепей ДНК или же потерей какой-то другой клеточной функции <...> recA и свой собственный ген. <...> ген-мишень Экспрессируемый ген recA Ген lexA Экспрессируемый ген-мишень Активированный RecA RecA запускает <...> активации RecA.

Предпросмотр: Гены по Льюину — 2-е изд., испр. и доп. (эл.)..pdf (1,0 Мб)
46

№4 [Генетика, 2018]

Журнал Генетика был основан в 1965 году, вскоре после окончания эры лысенковщины, когда генетика считалась реакционной псевдонаукой. Журнал внес значительный вклад в возрождение генетики в Советском Союзе. В журнале Генетика публикуются как обзоры, так и экспериментальные статьи в области теоретической и прикладной генетики, отражающие фундаментальные исследования генетических процессов на молекулярном, клеточном, организменном и популяционном уровнях. Особое внимание уделяется наиболее актуальным проблемам современной генетики, касающимся глобальных вопросов общемирового значения, таких как сохранение и рациональное использование генетических ресурсов и оценка, прогнозирование и предупреждение негативных генетических последствий загрязнения окружающей среды.

У арабидопсиса LUX/PCL1 (LUX ARRHYTHMO/PHYTOCLOCK 1) входит в состав так называемого “вечернего комплекса <...> Чуть позже LUX/PCL1 был идентифицирован на материале мягкой пшеницы. <...> RAD51 и DMC1 являются гомологами RECA, но, как оказалось, имеют различные функции в репарации DSBs в <...> Roles of RecA homologues Rad51 and Dmc1 during meiotic recombination // Cytogenet. <...> orthologs from Coprinus cinereus and Lycopersicon esculentum, and phylogenetic analysis of eukaryotic recA

Предпросмотр: Генетика №4 2018.pdf (0,0 Мб)
47

ИССЛЕДОВАНИЕ ФУНКЦИОНАЛЬНОСТИ ГЕНА METDI5511 METHYLOBACTERIUM DICHLOROMETHANICUM ДМ4 [Электронный ресурс] / Фирсова, Торгонская, Троценко // Прикладная биохимия и микробиология .— 2017 .— №2 .— С. 76-83 .— Режим доступа: https://rucont.ru/efd/593174

Автор: Фирсова

Получен нокаут-мутант Methylobacterium dichloromethanicum ДМ4 с инактивированным геном предполагаемого регулятора транскрипции METDI5511 (ΔMETDI5511), экспрессия которого многократно увеличивалась при выращивании на дихлорметане по сравнению с метанолом. Мутант характеризовался пониженной скоростью роста на дихлорметане по сравнению с исходным штаммом, а также оказался более чувствительным к воздействию различных видов стрессов (окислительный, осмотический, тепловой, высушивание). Исследование флуоресценции клеток, окрашенных Fluorescent Brightener 28 (Calcofluor white), показало существенное увеличение количества поверхностных полисахаридов с β-1,3 и β-1,4-гликозидными связями у мутанта ΔMETDI5511. Полученные результаты свидетельствуют об участии гена METDI5511 в регуляции состава поверхностных полисахаридов, играющих важную роль в адаптации клеток к росту на дихлорметане.

Данная работа Escherichia coli S17-1 F– thi pro recA hsdR [RP4-2Tc::Mu-Km::Tn7] Tpr Smr [26] Escherichia <...> coli TOP10 FmcrA Δ(mrr-hsdRMS-mcrBC) ϕ80lacZΔM15 ΔlacΧ74 recA1 araD139 Δ(ara-leu) 7697 galU galK rpsL

48

MYCOBACTERIUM AVIUM — АКТУАЛЬНЫЙ ВОЗБУДИТЕЛЬ МИКОБАКТЕРИОЗА ЧЕЛОВЕКА [Электронный ресурс] / Старкова // Инфекция и иммунитет .— 2013 .— №1 .— С. 7-14 .— Режим доступа: https://rucont.ru/efd/437052

Автор: Старкова

Микобактериоз — инфекционное заболевание животных и человека, возбудителями которого являются представители большой группы нетуберкулезных микобактерий, включающих М. avium complex. Несмотря на то, что передача М. avium от человека к человеку не доказана и микобактериоз носит спорадический характер, среди ВИЧ-инфицированных за последние десять лет наметилась тенденция к росту числа случаев диссеминированной формы заболевания, вызванного М. avium. Недостаток сведений о структуре популяции М. avium в России, отсутствие простых чувствительных методов микробиологической диагностики ограничивают возможности эпидемиологического мониторинга микобактериоза в нашей стране. Это диктует необходимость использования современных эффективных молекулярно-генетических методов исследования для выявления, видовой идентификации и типирования М. avium. Так, использование методов выявления инсерционного элемента IS901, анализа полиморфизма рестрикционных фрагментов гена hsp65 и элемента IS1245 позволяет провести идентификацию и определение подвида M. avium. Исследование геномного полиморфизма штаммов M. avium для оценки структуры популяции возможно с помощью комплекса молекулярно-генетических методов VNTR-типирования, IS1245- и IS1311-RFLP-типирования.

ДНК-гиразы), secA1 (кодирует белок Sec1, обеспечивающий транспорт белков через цитоплазматическую мембрану), recA <...> philoge-4. netic relationships among 19 rapidly growing Mycobacterium species by 16S rRNA, hsp65, sodA, recA

49

МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ ДЕТЕРМИНАНТ, ОПРЕДЕЛЯЮЩИХ СИНТЕЗ 2,4-ДИАЦЕТИЛФЛОРОГЛЮЦИНОЛА БАКТЕРИЯМИ PSEUDOMONAS BRASSICAСEARUM БИМ В-446 [Электронный ресурс] / Литвинкович [и др.] // Прикладная биохимия и микробиология .— 2017 .— №1 .— С. 40-48 .— Режим доступа: https://rucont.ru/efd/593156

Автор: Литвинкович

На основании полноразмерного сиквенса генома бактерий Pseudomonas brassicacearum БИМ В-446 установлена нуклеотидная последовательность локуса, кодирующая синтез антибиотика 2,4-диацетилфлороглюцинола. Показано, что в пределах нуклеотидной последовательности размером 9087 п. н. локализованы открытые рамки считывания, гомологичные (96–99% идентичных остатков) структурным (phlA, phlC, phlB, phlD, phlE и phlI) и регуляторным (phlF, phlG и phlH) генам бактерий Pseudomonas brassicacearum и Pseudomonas fluorescens, детерминирующим продукцию 2,4-диацетилфлороглюцинола. Оказалось, что близкородственные phl-опероны различались их окружением (на 3'-конце были локализованы различные гены). Установлено, что инактивация гена phlA приводила к потере способности бактерий P. brassicacearum БИМ В-446 синтезировать антибиотик и подавлять рост фитопатогенных грибов Fusarium culmorum, F. oxysporum, Botrytis cinerea, а также снижалась антимикробная активность по отношению к грибным (Alternaria alternate) и бактериальным патогенам (Pseudomonas syringae и Pectobacterium carotovorum). При инактивации регуляторного гена phlF, детерминирующего синтез транскрипционного репрессора phl-оперона, повышалась продукция 2,4-диацетилфлороглюцинола. В отличие от бактерий дикого типа phlF-мутанты синтезировали антибиотик, который обнаруживался в культуральной жидкости после 12 ч культивирования, а его содержание достигало максимальных значений в среде, содержащей сахарозу в качестве источника углерода

корневой гнили томата » A. alternata F-C-1 Прототроф, возбудитель альтернариоза огурца » E. coli BW19851 recA <...> , ΩRP4tra, uidA::pir+ [10] E. coli XL1-Blue F'::Tn10(TcR) proA+B+lacIqΔ(lacZ)M15/recA1 endA1, gуrA96(

50

№2 [Вестник Томского государственного университета. Управление, вычислительная техника и информатика, 2016]

Научный журнал был выделен в самостоятельное периодическое издание из общенаучного журнала «Вестник Томского государственного университета» в 2007 г. В журнале публикуются результаты теоретических и прикладных исследований вузов, научно-исследовательских, проектных и производственных организаций в области управления, вычислительной техники и информатики в технических, экономических и социальных системах. Входит в Перечень ВАК.

Аналогично низкочастотные компоненты RecA1, RecA2, …, RecA6 получаются восстановлением только по одному <...> раскладывается в сумму следующих компонент: Fragment = RecD1 + RecD2 + RecD3 + RecD4 + RecD5 + RecD6 + RecA6 <...> Числовые характеристики компонент сигнала Для всех полученных компонент RecD1, RecD2, …, RecD6 и RecA6 <...> signal is decomposed into wavelet components EEG = RecD1 + RecD2 + RecD3 + RecD4 + RecD5 + RecD6 + RecA6 <...> , where RecD4, RecD5, RecD6, and RecA6 are classic ranges of Beta, Alpha, Theta and Delta, respectively

Предпросмотр: Вестник Томского государственного университета. Управление, вычислительная техника и информатика №2 2016.pdf (0,6 Мб)
Страницы: 1 2 3 ... 42