Национальный цифровой ресурс Руконт - межотраслевая электронная библиотека (ЭБС) на базе технологии Контекстум (всего произведений: 569456)
Консорциум Контекстум Информационная технология сбора цифрового контента
Уважаемые СТУДЕНТЫ и СОТРУДНИКИ ВУЗов, использующие нашу ЭБС. Рекомендуем использовать новую версию сайта.
  Расширенный поиск
Результаты поиска

Нашлось результатов: 597 (0,78 сек)

Свободный доступ
Ограниченный доступ
Уточняется продление лицензии
1

Состав микробиоты кишечника и его взаимосвязь с факторами риска сердечно-сосудистых заболеваний среди относительно здоровых жителей Москвы и Московской области / Д.А. Каштанова [и др.] // Кардиоваскулярная терапия и профилактика .— 2017 .— №3 .— С. 56-61 .— URL: https://rucont.ru/efd/634276 (дата обращения: 16.09.2021)

Автор: Каштанова

Цель. Изучить взаимосвязь состава микробиоты кишечника с факторами кардиоваскулярного риска у лиц без клинических проявлений сердечно-сосудистых заболеваний Материал и  методы. В  исследование были включены 92 жителя Москвы и  Московской области, мужчины и  женщины в  возрасте 25-76 лет без клинических проявлений хронических неинфекционных заболеваний, не  получающие никакой медикаментозной терапии, но с возможным наличием кардиоваскулярных факторов риска. Все участники прошли предварительное обследование, включавшее физический осмотр, клинический и биохимический анализы крови, электрокардиографию, тредмил-тест, оценку наличия факторов сердечно-сосудистого риска, а  также секвенирование вариабельных участков V3-V4 гена 16S рРНК микробиоты кишечника. Результаты. В ходе исследования было обнаружено, что в исследуемой когорте лиц условно-патогенные бактерии были в большей степени представлены в  образцах доноров с  наличием факторов кардиоваскулярного риска: рода Serratia  — у  лиц с  ожирением и нарушением метаболизма глюкозы, рода Prevotella — с ожирением, нарушением метаболизма глюкозы и повышением систолического артериального давления, рода Blautia — с нарушением метаболизма глюкозы и повышением систолического артериального давления. Амилолитические бактерии рода Oscillosipa в меньшей степени представлены у лиц с ожирением. Заключение. Дисбаланс микробиоты кишечника с повышением уровня условно-патогенных бактерий, потенциально инициирующих системное неспецифическое воспаление, ассоциирован с наличием факторов кардиоваскулярного риска.

кардиоваскулярного риска: рода Serratia — у лиц с ожирением и нарушением метаболизма глюкозы, рода Prevotella <...> В старших возрастных группах уровень Bacteroidetes и Prevotella был достоверно ниже, чем в группах более <...> (все обследованные, n=92) 0,5661 0,1230 4,6027 <0,001 Prevotella САД ≥140 мм рт.ст. <...> Бактерии родов Serratia и Prevotella в большей степени были представлены среди участников с ожирением <...> Представленность бактерий рода Prevotella снижалась с возрастом.

2

Савичук, Н.О. Коррекция микроэкологических нарушений как составляющая лечебно-профилактических мероприятий у детей с хроническим генерализованным катаральным гингивитом / Н.О. Савичук, И.А. Трубка, О.А. Марченко // Стоматология. Эстетика. Инновации .— 2017 .— №1 .— С. 87-95 .— URL: https://rucont.ru/efd/620345 (дата обращения: 16.09.2021)

Автор: Савичук

Заболевания тканей пародонта являются одними из самых распространенных стоматологических заболеваний, начинающихся в детском возрасте и имеющих риск прогрессировать на протяжении всей жизни. Наиболее тяжелой формой заболевания у детей является хронический генерализованный катаральный гингивит (ХГКГ). Разработка алгоритма эффективного лечения с учетом коррекции микроэкологии является актуальной задачей. В группу наблюдения вошли 140 детей школьного возраста с хроническим генерализованным катаральным гингивитом. Подтверждена значимость обсемененности десневой борозды пародонтопатогенными бактериями как фактора риска формирования ХГКГ у детей школьного возраста. У 22±5,26% детей идентифицирован один вид пародонтопатогенных микроорганизмов, у 62±6,16% – два вида, у 16±4,66% – три вида и более. Выявлена зависимость увеличения показателей обсемененности с ростом тяжести заболевания. При легкой форме заболевания в 53±12,88% случаев выявили ассоциацию микроорганизмов, а в 47±9,11% – один из микроорганизмов, преимущественно Actinobacillus actinomycetemcomitans и Treponema denticola. При среднетяжелой форме поражения у 91±6,13% детей выявлены ассоциации двух, а у 9±6,13% – трех микроорганизмов. В состав ассоциаций в этих случаях входили Bacteroides forsithus, Treponema denticola, в 82±11,63% случаев – Porphyromonas gingivalis, в 46±15,01% случаев – Actinobacillus actinomycetemcomitans. У 80±17,88% детей с тяжелой формой гингивита в состав ассоциаций входят три и более вида микроорганизмов. У всех детей с тяжелой формой идентифицируют Porphyromonas gingivalis, Prevotella intermedia, Bacteroides forsithus, у 80±17,88% детей – Treponema denticola и Actinobacillus actinomycetemcomitans. Разработан комплекс лечебно-профилактических мероприятий у детей в зависимости от степени тяжести ХГКГ, включающий поэтапное проведение лечебно-профилактических мероприятий. При наличии пародонтопатогенных бактерий после профессиональной гигиены дополнительно осуществляли фотодинамическую терапию. Для коррекции колонизационной резистентности и эрадикации пародонтопатогенных бактерий назначали пробиотик, содержащий L. reuteri Protectis (DSM 17938) и L. reuteri Prodentis (PTA 5289) – «БиоГая ПроДентис», а в качестве источника кальция препараты кальция цитрата и холекальциферола. Под влиянием предложенной лечебно-профилактической тактики наблюдали эффективную эрадикацию пародонтопатогенных бактерий и увеличение промежутков между рецидивами и уменьшение количества рецидивов.

У всех детей с тяжелой формой идентифицируют Porphyromonas gingivalis, Prevotella intermedia, Bacteroides <...> All children with severe identify Porphyromonas gingivalis, Prevotella intermedia, Bacteroides forsithus <...> У всіх дітей з важкою формою ідентифікують Porphyromonas gingivalis, Prevotella intermedia, Bacteroides <...> У всех детей с тяжелой формой идентифицировали Porphyromonas gingivalis, Prevotella intermedia, Bacteroides <...> У всех детей с тяжелой формой идентифицируют Porphyromonas gingivalis, Prevotella intermedia, Bacteroides

3

ВИДОВОЕ РАЗНООБРАЗИЕ МИКРОФЛОРЫ В ПРОБАХ УРОГЕНИТАЛЬНОГО ТРАКТА ПАЦИЕНТОК КРУПНОЙ СЕТЕВОЙ ЛАБОРАТОРИИ И ЕГО ЗАВИСИМОСТЬ ОТ СОДЕРЖАНИЯ ЛАКТОБАКТЕРИЙ / Н.В. Фоменко [и др.] // Клиническая лабораторная диагностика .— 2015 .— №3 .— С. 61-66 .— URL: https://rucont.ru/efd/394493 (дата обращения: 16.09.2021)

Автор: Фоменко

Методом полимеразной цепной реакции в реальном времени (ПЦР-РВ) проведена оценка содержания ДНК лактобактерий (ЛБ), а также некоторых видов аэробных и анаэробных условно-патогенных бактерий (УПБ) в выборке соскобов урогенитального тракта женщин – пациенток сетевой лаборатории ИНВИТРО. Показано, что снижение содержания ЛБ в общей бактериальной массе (ОБМ) сопровождается повышением встречаемости, концентрации и относительного содержания всех видов условных патогенов, кроме уреаплазм. Для разных видов условных патогенов эти изменения выражены в разной степени. Отмечено повышение видового разнообразия микрофлоры урогенитального тракта при снижении содержания ЛБ.

Для ДНК G. vaginalis, Prevotella spp., Veillonella spp., Anaerococcus spp. и Atopobium vaginae считали <...> Следующими по частоте встречаемости были бактерии рода Prevotella, представленные как минимум 5 видами <...> Как и гарднереллы, представители рода Prevotella часто (до 55%) встречаются в низких титрах у клинически <...> В наименьшей степени это касалось G.vaginalis, Prevotella spp., Anaerococcus spp. и Veillonellaсeae, <...> Для наиболее часто встречающихся УПБ (G. vaginalis и prevotella spp.) отмечена положительная корреляция

4

Амхадова, М.А. ЭФФЕКТИВНОСТЬ ПРИМЕНЕНИЯ ФОТОДИНАМИЧЕСКОЙ ТЕРАПИИ В КОМПЛЕКСНОМ ЛЕЧЕНИИ ПАЦИЕНТОВ С ХРОНИЧЕСКИМ ГЕНЕРАЛИЗОВАННЫМ ПАРОДОНТИТОМ / М.А. Амхадова, И.С. Копецкий, В.В. Прокопьев // Российский стоматологический журнал .— 2016 .— №1 .— С. 14-17 .— URL: https://rucont.ru/efd/389363 (дата обращения: 16.09.2021)

Автор: Амхадова

Проведено исследование клинической и антимикробной эффективности фотодинамической терапии в комплексном лечении пациентов с хроническим генерализованным пародонтитом (ХГП) средней и тяжелой степеней. В ходе лечения пародонтита средней степени тяжести проводили 1 сеанс лазерной фотодинамической терапии непосредственно после мероприятий профессиональной гигиены. При лечении пациентов с ХГП тяжелой степени фотодинамическую терапию проводили дважды: после профессиональной гигиены и после хирургического лечения (лоскутных операций). Анализ ближайших и отдаленных результатов показал, что включение в комплексное лечение антимикробной фотодинамической терапии позволило не только существенно снизить содержание основных пародонтопатогенных микроорганизмов в пародонтальных карманах по данным ПЦР-исследования, но и достичь положительного клинического эффекта.

которых наибольшее значение имеют виды Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Prevotella <...> 5 пародонтопатогенных бактерий: Aggregatibacter actinomycetemcomitans , Porphyromonas gingivalis , Prevotella <...> отношении трех видов микроорганизмов: Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis и Prevotella <...> Высокий бактерицидный эффект против пигментообразующих бактерий, таких как Porphyromonas gingivalis, Prevotella <...> оказывала на три вида микроорганизмов: Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis и Prevotella

5

Соснова, Е.А. МИКРОБНЫЙ ПЕЙЗАЖ МОЧИ ПАЦИЕНТОК РЕПРОДУКТИВНОГО ВОЗРАСТА, ПОЛУЧАЮЩИХ ТЕРАПИЮ ГЛЮКОКОРТИКОСТЕРОИДАМИ / Е.А. Соснова, Л.В. Тумбинская // Архив акушерства и гинекологии им. В.Ф. Снегирева .— 2015 .— №2 .— С. 32-37 .— URL: https://rucont.ru/efd/390876 (дата обращения: 16.09.2021)

Автор: Соснова

Исследованы образцы клеточного осадка мочи, полученные от 27 женщин репродуктивного возраста с системными заболеваниями и болезнями почек, находящихся на терапии глюкокортикостероидами. Исследование проводили методом количественной полимеразной цепной реакции в режиме реального времени (тест Фемофлор производства НПО «ДНК-Технология», РФ). В результате исследования оценивали качественный и количественный состав бактерий, выявленных в моче пациенток.

, получающих терапию ГКС, формировался за счет присутствия следующих групп: Gardnerella vaginalis + Prevotella <...> 0,0 0,0—0,0 0,0—3,5 10 37,0 Staphylococcus spp. 0,0 0,0—0,0 0,0—3,2 3 11,1 Gardnerella vaginalis + Prevotella <...> Снегирева, № 2, 2015 ставителей двух групп облигатно-анаэробных микроорганизмов: Gardnerella vaginalis + Prevotella <...> находки в образцах, полученных от здоровых женщин, микроорганизмов группы Gardnerella vagi nalis + Prevotella <...> микробного пейзажа уретры и мочевого пузыря у пациенток, получающих терапию ГКС: Gardnerella vagi nalis + Prevotella

6

ИЗМЕНЕНИЯ МИКРОБИОТЫ И РАЗВИТИЕ НЕСПЕЦИФИЧЕСКОГО ВОСПАЛЕНИЯ В ПОЛОВЫХ ОРГАНАХ САМОК МЫШЕЙ ИНБРЕДНОЙ ЛИНИИ C57BL/6 ПРИ АЭРОЗОЛЬНОМ ИНФИЦИРОВАНИИ / С.И. Каюкова [и др.] // Бюллетень экспериментальной биологии и медицины .— 2019 .— №5 .— URL: https://rucont.ru/efd/685589 (дата обращения: 16.09.2021)

Автор: Каюкова

Инфекционный процесс в легких уже на начальном этапе после аэрозольного заражения мышей Mycobacterium tuberculosis вызывает быстрые изменения состава микробиоты влагалища. Наблюдалось снижение количества и разнообразия флоры, а также частичное восстановление нормального микробного сообщества. Изменение микробиоты влагалища выявлялось уже на 3-7-е сутки легочной инфекции, тогда как воспалительные изменения появлялись к 35-м суткам. Воспаление в половых органах на ранних сроках инфекции не наблюдалось. Также не были обнаружены культивируемые микобактерии или ДНК M. tuberculosis

При этом регистрировали скудный (аэробно� анаэробный) тип биотопа: Prevotella bivia/Porphyro? <...> В структуре ваги� нальной микробиоты наиболее показательными бы� ли Enterobacterium spp., Prevotella <...> Отмечали снижение Prevotella bivia/Porphy? <...> rium spp., Staphylococcus spp., Prevotella bivia/Por? <...> 1.3 2.4±1.2 2.1±0.9 2.2±0.5 2.2±0.6 2.0±0.6 Staphylococcus spp. — — 1.2±0.3 1.5±0.3 0.7±0.1 0.6±0.1 Prevotella

7

КЛИНИКО-МИКРОБИОЛОГИЧЕСКАЯ ХАРАКТЕРИСТИКА ДИСБИОТИЧЕСКИХ ИЗМЕНЕНИЙ СЛИЗИСТОЙ ОБОЛОЧКИ ПОЛОСТИ РТА И РОТОГЛОТКИ / А.И. Крюков [и др.] // Медицинский совет .— 2016 .— №6 Оториноларингология .— С. 34-37 .— URL: https://rucont.ru/efd/435234 (дата обращения: 16.09.2021)

Автор: Крюков

Дисбиоз ротовой полости и ротоглотки характеризуется снижением качественного и количественного состава микроорганизмов (бактерий, вирусов, грибов), в норме обитающих в ротовой полости, а также появлением других видов микроорганизмов, не характерных для данного биотопа. По данным зарубежных авторов, более чем 700 видов бактерий и других микроорганизмов обитают в ротовой полости человека, формируя сложные полимикробные ассоциации («биопленки») на различных биотических и абиотических поверхностях анатомических элементов, располагающихся в полости рта и ротоглотки [1, 2].

При этом среди других бактерий наиболее часто высевают представителей семейства Prevotellaceae (Prevotella <...> intermedia, Prevotella melaninogenica, Prevotella buccae, Prevotella oralis, Prevotella denticola), <...> Porphyromonas gingivalis, Porphyromonas endodontalis, Prevo tella intermedia and Prevotella nigrescens

8

ИЗМЕНЕНИЯ МИКРОБИОТЫ И РАЗВИТИЕ НЕСПЕЦИФИЧЕСКОГО ВОСПАЛЕНИЯ В ПОЛОВЫХ ОРГАНАХ САМОК МЫШЕЙ ИНБРЕДНОЙ ЛИНИИ C57BL/6 ПРИ АЭРОЗОЛЬНОМ ИНФИЦИРОВАНИИ MYCOBACTERIUM TUBERCULOSIS / С.И. Каюкова [и др.] // Бюллетень экспериментальной биологии и медицины .— 2019 .— №5 .— URL: https://rucont.ru/efd/694128 (дата обращения: 16.09.2021)

Автор: Каюкова

Инфекционный процесс в легких уже на начальном этапе после аэрозольного заражения мышей Mycobacterium tuberculosis вызывает быстрые изменения состава микробиоты влагалища. Наблюдалось снижение количества и разнообразия флоры, а также частичное восстановление нормального микробного сообщества. Изменение микробиоты влагалища выявлялось уже на 3-7-е сутки легочной инфекции, тогда как воспалительные изменения появлялись к 35-м суткам. Воспаление в половых органах на ранних сроках инфекции не наблюдалось. Также не были обнаружены культивируемые микобактерии или ДНК M. tuberculosis

При этом регистрировали скудный (аэробно� анаэробный) тип биотопа: Prevotella bivia/Porphyro? <...> В структуре ваги� нальной микробиоты наиболее показательными бы� ли Enterobacterium spp., Prevotella <...> Отмечали снижение Prevotella bivia/Porphy? <...> rium spp., Staphylococcus spp., Prevotella bivia/Por? <...> 1.3 2.4±1.2 2.1±0.9 2.2±0.5 2.2±0.6 2.0±0.6 Staphylococcus spp. — — 1.2±0.3 1.5±0.3 0.7±0.1 0.6±0.1 Prevotella

9

СРАВНЕНИЕ ЭФФЕКТИВНОСТИ АНТИБИОТИКОВ, ИСПОЛЬЗУЕМЫХ ДЛЯ АНТИБИОТИКОПРОФИЛАКТИКИ ПРИ ОСТРОМ АППЕНДИЦИТЕ / Д.Л. Колесников [и др.] // Хирургическая практика .— 2013 .— №2 .— С. 44-47 .— URL: https://rucont.ru/efd/577451 (дата обращения: 16.09.2021)

Автор: Колесников

Цель: сравнить эффективность применения ампициллина/сульбактама, цефазолина, цефтриаксона в качестве препарата антибиотикопрофилактики по снижению числа послеоперационных инфекционных раневых осложнений при остром аппендиците

Прочие в 11-и случаях: Klebsiella oxytoca (2), Flavobacterium mizutaii, Prevotella bivia, Actinomyces <...> The others – in 11 cases: Klebsiella oxytoca (2), Flavobacterium mizutaii, Prevotella bivia, Actinomyces <...> 100,0 2 Рез. 0 0 2 100,0 0 0 Flavobacterium mizutaii Чув. 0 0 1 100,0 0 0 1 Рез. 1 100,0 0 0 1 100,0 Prevotella <...> 1 Рез. 0 0 1 100,0 1 100,0 Propionibacterium avidum Чув. 1 100,0 0 0 0 0 1 Рез. 0 0 1 100,0 1 100,0 Prevotella

10

ПРИМЕНЕНИЕ МЕТОДА ПЦР В РЕАЛЬНОМ ВРЕМЕНИ ДЛЯ ИЗУЧЕНИЯ МИКРОБИО- МА ПАРОДОНТА У ПАЦИЕНТОВ С СОЧЕТАННОЙ ПАТОЛОГИЕЙ ГАСТРОДУОДЕ- НАЛЬНОЙ ЗОНЫ И ХРОНИЧЕСКИМ ПАРОДОНТИТОМ / А.В. Шибаева [и др.] // Молекулярная генетика, микробиология и вирусология .— 2016 .— №1 .— С. 28-32 .— URL: https://rucont.ru/efd/399111 (дата обращения: 16.09.2021)

Автор: Шибаева

C применением метода ПЦР в реальном времени (набор Дентофлор) проанализирована выборка из 54 пациентов с различной степенью выраженности хронического пародонтита, включающая 38 больных хроническим гастритом. Впервые показано, что пародонт мужчин как в норме, так и при хроническом пародонтите существенно более колонизирован Treponema denticola, чем пародонт женщин. Показано, что на пародонте больных хроническим гастритом обнаруживается существенно больше геномной ДНК человека, чем у лиц без гастрита. Методами непараметрической статистики показана высокая ассоциация колонизации пародонта бактериями T. forsythensis и T. denticola, но не Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis и Prevotella intermedia с развитием хронического пародонтита.

forsythensis и T. denticola, но не Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis и Prevotella <...> пародонт; гастрит; ПЦРРВ; Дентофлор; Aggregatibacter actinomycetemcomitans; Porphyromonas gingivalis; Prevotella <...> пяти пародонтопатогенных бактерий: Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Prevotella <...> Подвижность Кровоточивость Общая бакт. масса Actinobacillus actinomycetemcomitans Porhpyromonas gingivalis Prevotella <...> gastritis, real-time PCR, dentoflor, Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Prevotella

11

Лабораторная диагностика бактериального вагиноза – оценка состояния влагалищного биотопа / Н.А. Бадыгина [и др.] // Лабораторная диагностика Восточная Европа .— 2014 .— №1 .— С. 112-119 .— URL: https://rucont.ru/efd/494556 (дата обращения: 16.09.2021)

Автор: Бадыгина

Статья посвящена проблеме диагностики бактериального вагиноза. Подробно рассматриваются вопросы патогенеза, клинические и лабораторные методы диагностики данного заболевания с оценкой их особенностей, достоинств и недостатков. Особое внимание уделено роли в оценке состояния влагалищного биотопа молекулярных и культуральных технологий.

., Prevotella sp., Atopobium sp. <...> ., Prevotella sp., Atopobium sp.; соотношение анаэробы: аэробы – 100:1–1000:1; отсутствуют или снижена <...> что в развитие БВ может быть вовлечено множество микроорганизмов, таких как Gardnerella vaginalis, Prevotella <...> бактерий, как Gardnerella, Atopobium, Megasphaera, Eggerthella, Aerococcus, Leptotrichia/Sneathia, Prevotella

12

Лавренова, Г.В. ЛОР-ПАТОЛОГИЯ КАК ПРИЧИНА ХАЛИТОЗА / Г.В. Лавренова, С.А. Карпищенко, О.А. Куликова // Российская оториноларингология .— 2015 .— №4 .— С. 65-68 .— URL: https://rucont.ru/efd/429987 (дата обращения: 16.09.2021)

Автор: Лавренова

Представлен обзор современной англоязычной литературы относительно халитоза. Приведены современные взгляды на этиологию, классификацию, субъективную и инструментальную диагностику и лечение данного состояния. Описана патология ЛОРорганов, являющаяся причиной вторичного халитоза.

Определенную роль играют бактерии рода Prevotella (P. intermedia и P. loeschii) и Fusobacterium nucleatum <...> Krespi и соавт., также подтверждая участие Prevotella и Fusobacterium в генезе халитоза, упоминают и <...> Следует отметить, что некоторые исследования, хотя и постулируют способность Prevotella intermedia, Fusobacterium <...> Prevotella intermedia, Fusobacterium nucleatum и Campylobacter rectus способны продуцировать летучие

13

Молекулярно-генетический метод выявления пародонтопатогенных микроорганизмов в практике врача-стоматолога. / А.В. Сергеева [и др.] // Клиническая лабораторная диагностика .— 2016 .— №9 .— С. 134-134 .— URL: https://rucont.ru/efd/487184 (дата обращения: 16.09.2021)

Автор: Сергеева

По данным ВОЗ, болезни пародонта наряду с кариесом зубов и его осложнениями являются самыми распространенными стоматологическими заболеваниями. Воспалительные заболевания пародонта регистрируются среди различных возрастных группа населения в более чем 80% случаев. В многочисленных научных исследованиях доказано, что в основе патогенеза заболеваний пародонта лежит взаимодействие факторов иммунологической реактивности человека и пародонтопатогенной микрофлоры ротовой полости.

причинами развития заболеваний пародонта являются следующие микроорганизмы: Porphyromonas gingivalis, Prevotella <...> Treponema denticola) приходилось 22,75±12,8%, а на группу с умеренным риском (Fusobacterium nucleatum , Prevotella <...> риском преобладала Tannerella forsythia – 42,2±19,0%, а частота выявления Fusobacterium nucleatum и Prevotella

14

ИССЛЕДОВАНИЕ МИКРОБИОТЫ КИШЕЧНИКА ПРИ БОЛЕЗНИ ПАРКИНСОНА / В.А. Петров [и др.] // Бюллетень экспериментальной биологии и медицины .— 2016 .— №12 .— С. 32-35 .— URL: https://rucont.ru/efd/605862 (дата обращения: 16.09.2021)

Автор: Петров

Исследована микробиота кишечника у пациентов с болезнью Паркинсона и у здоровых людей методом высокопроизводительного секвенирования бактериальных генов 16S рРНК. Установлено, что при болезни Паркинсона происходит изменение содержания 9 родов и 15 видов микроорганизмов: микробиота кишечника больных характеризуется снижением содержания бактерий Dorea, Bacteroides, Prevotella, Faecalibacterium, Bacteroides massiliensis, Stoquefichus massiliensis, Bacteroides coprocola, Blautia glucerasea, Dorea longicatena

микроорганизмов: микробиота кишечника больных характеризуется снижением содержания бактерий Dorea, Bacteroides, Prevotella <...> Bacteroides coprocola, Blautia glucerasea, Dorea longicatena, Bacteroides dorei, Bacteroides plebeus, Prevotella <...> этом контрольная группа характеризовалась более высоким содержанием бактерий Dorea, Bacteroi� des, Prevotella <...> Bacteroides coprocola, Blautia glucerasea, Dorea lon� gicatena, Bacteroides dorei, Bacteroides plebeus, Prevotella

15

Товстановская, В.А. Бактериальный вагиноз (оптимизация лечения) / В.А. Товстановская, Т.В. Цапенко, А.Е. Алаторских // Репродуктивное здоровье. Восточная Европа .— 2016 .— №1 .— С. 125-138 .— URL: https://rucont.ru/efd/476083 (дата обращения: 16.09.2021)

Автор: Товстановская

Проблема бактериального вагиноза в гинекологической и акушерской практике связана с широкой распространенностью данной патологии среди женщин репродуктивного возраста. Так, среди небеременных женщин репродуктивного возраста частота выявления бактериального вагиноза составляет 15–25%, во время беременности в группах повышенного риска она увеличивается до 30–38%. Научно-практический интерес к данной проблеме обусловлен наличием патогенетической связи дисбиоза влагалища с воспалительными заболеваниями органов малого таза, невынашиванием беременности, фетоплацентарной недостаточностью, внутриутробным инфицированием плода. Кроме того, бактериальный вагиноз повышает вероятность развития цервикальной интраэпителиальной неоплазии и увеличивает риск заболеваний, передающихся половым путем

., Gardnerella vaginalis/Prevotella bivia/Porphyromonas spp., Eubacterium spp., Sneathia spp. / Leptotrihia <...> ovatus, Bacteroides thetaiotaomicron, Bacteroides vulgatus), Fusobacterium spp., Veillonella spp., Prevotella <...> (Prevotella bivia, Prevotella buccae, Prevotella disiens) и некоторых грамположительных микроорганизмов <...> (включая Bacteroides fragilis и Prevotella melaninogenica), Fusobacterium spp., Propionibacterium spp

16

Разработка метода количественной оценки степени IgE-опосредованной специфической сенсибилизации при бруцеллезе. / Н.С. Саркисян [и др.] // Клиническая лабораторная диагностика .— 2016 .— №9 .— С. 133-134 .— URL: https://rucont.ru/efd/487183 (дата обращения: 16.09.2021)

Автор: Саркисян

Патогенетическая особенность бруцеллеза – формирование реакций замедленной и немедленной гиперчувствительности. К настоящему времени не предложено информативного методического подхода для оценки интенсивности IgEопосредованной сенсибилизации при бруцеллезе. Известно, что в развитии гиперчувствительности немедленного типа ведущая роль отводится базофилам.

причинами развития заболеваний пародонта являются следующие микроорганизмы: Porphyromonas gingivalis, Prevotella <...> Treponema denticola) приходилось 22,75±12,8%, а на группу с умеренным риском (Fusobacterium nucleatum , Prevotella <...> риском преобладала Tannerella forsythia – 42,2±19,0%, а частота выявления Fusobacterium nucleatum и Prevotella

17

Бластоцисты как возбудители оппортунистической инфекции. / В.П. Сергиев [и др.] // Клиническая лабораторная диагностика .— 2016 .— №9 .— С. 134-135 .— URL: https://rucont.ru/efd/487185 (дата обращения: 16.09.2021)

Автор: Сергиев

Blastocystis spp. – эукариотный паразитический одноклеточный организм – обитатель просвета толстого кишечника человека и многих животных без предпочтения к какому-либо типу хозяина.

причинами развития заболеваний пародонта являются следующие микроорганизмы: Porphyromonas gingivalis, Prevotella <...> Treponema denticola) приходилось 22,75±12,8%, а на группу с умеренным риском (Fusobacterium nucleatum , Prevotella <...> риском преобладала Tannerella forsythia – 42,2±19,0%, а частота выявления Fusobacterium nucleatum и Prevotella

18

ЭФФЕКТИВНОСТЬ ПРИМЕНЕНИЯ СРЕДСТВА НА ОСНОВЕ БАКТЕРИОФАГОВ В КОМПЛЕКСНОМ ЛЕЧЕНИИ ЗАБОЛЕВАНИЙ СЛИЗИСТОЙ ОБОЛОЧКИ ПОЛОСТИ РТА / Е.А. Волков [и др.] // Российский стоматологический журнал .— 2015 .— №4 .— С. 20-24 .— URL: https://rucont.ru/efd/389317 (дата обращения: 16.09.2021)

Автор: Волков

Эффективное комплексное лечение пациентов с патологией слизистой оболочки полости рта включает медикаментозное воздействие на патогенные бактерии как возможный этиологический фактор в развитии этих заболеваний. В настоящей работе изучена эффективность отечественного профилактического средства для местного применения «Фагодент» в виде геля на основе бактериофагов в комплексном лечении хронического рецидивирующего афтозного стоматита (ХРАС) и плоского лишая (ПЛ). Для контроля эффективности in vitro у пациентов основной группы проведены идентификация патогенов полости рта, Spot-тестирование на бактериальном газоне, изучена антибиотикорезистентность бактерий.

Aggregatibacter actinomycetemcomitans; Porphyromonas gingivalis; Bacteroides gracilis; Bacteroides forsythus; Prevotella <...> реального времени («real time») с использованием набора праймеров фирмы «Литех» к 6 пародонтопатогенам: Prevotella <...> Так, анализ результатов показал наличие Aggregatibacter actinomicetemcomitans, Prevotella intermedia, <...> Aggregatibacter actinomicetemcomitansАнаэробные условия: Enterococcus raffinosus Prevotella intermedia

19

№6 [Российский журнал кожных и венерических болезней, 2020]

Основан в 1998 г. Главный редактор журнала - Иванов Олег Леонидович - доктор медицинских наук, член EASE, профессор кафедры кожных и венерических болезней им. В.А. Рахманова лечебного факультета ГБОУ ВПО Первый МГМУ им. И.М. Сеченова Минздрава России. В журнале освещаются проблемы дерматологии, венерологии, дерматоонкологии. Журнал использует различные формы подачи материала, выделены такие разделы, как: пиококковые заболевания кожи, микозы, дерматоонозы, пузырные дерматозы, дерматокосметология. Регулярно публикуется информация о новых книгах и руководствах по дерматовенерологии, вопросы тестового характера, клинические задачи и многое другое.

К л ю ч е в ы е с л о в а: бактериальный вагиноз; Gardnerella vaginalis; Prevotella; Atopobium vaginae <...> Significant decreases in Gardnerella vaginalis, Atopobium vaginae, Prevotella spp., Leptotrichia amnionii <...> K e y w o r d s : bacterial vaginosis; Gardnerella vaginalis; Prevotella; Atopobium vaginae; recurrences <...> Gardnerella vaginalis Prevotella spp. <...> Однако через 6 мес после терапии количество выявленных Gardnerella vaginalis, Prevotella spp.

Предпросмотр: Российский журнал кожных и венерических болезней №6 2020.pdf (0,6 Мб)
20

Бикбавова, Г.Р. Модуляция интестинального микробиома в формировании язвенного колита / Г.Р. Бикбавова, М.А. Ливзан // Вестник Российской академии медицинских наук .— 2020 .— №6 .— С. 6-13 .— URL: https://rucont.ru/efd/750534 (дата обращения: 16.09.2021)

Автор: Бикбавова

Целью подготовки обзора является обобщение имеющейся информации о влиянии факторов окружающей среды и микробиома кишечника на возникновение и развитие язвенного колита, роли продуктов метаболизма бактерий в патогенезе этого заболевания. Изучив литературные источники, мы пришли к выводу, что образ жизни в эпоху постиндустриального общества оказывает существенное влияние на микробный пейзаж кишечника и приводит к изменению его разнообразия у больных, страдающих язвенным колитом, в частности к уменьшению числа резидентной флоры с противовоспалительной активностью, синтезирующих короткоцепочечные жирные кислоты, и увеличению числа условно-патогенных и патогенных микроорганизмов. Внутри филумов Firmicutes и Proteobacteria изменяется пропорциональное соотношение. Совокупность факторов агрессии (нарушения состава кишечного микробиома, наличия агрессивных кишечных метаболитов) приводит к нарушению проницаемости слизистой оболочки кишки, снижается ее барьерная функция. Через дефекты слизистой оболочки в более глубокие слои стенки кишки могут проникать пищевые и бактериальные агенты, которые затем стимулируют развитие воспалительных и иммунных реакций

В энтеротипе-1 преобладает род Bacteroides, в энтеротипе-2 — Prevotella, в энтеротипе-3 — Ruminococcus <...> Энтеротип-1 с высоким содержанием Bacteroides и низким содержанием Prevotella обнаружен у людей, находящихся <...> Энтеротип-2 характеризуется высоким содержанием Prevotella, низким Bacteroides и связан с растительной <...> Heliospirillum Leuconostoc Mycoplasma Spiroplasma Sporomusa Staphylococcus Streptococcus Bacteroides Prevotella <...> Внутри типа Bacteroidetes бактериальные штаммы рода Prevotella, чьи ферменты разрушают растительное волокно

21

Решетников, О.В. ИНФЕКЦИИ ПАРОДОНТА И ИХ ВОЗМОЖНОЕ ВЛИЯНИЕ НА РАЗВИТИЕ АТЕРОСКЛЕРОЗА И ЕГО ОСЛОЖНЕНИЙ / О.В. Решетников, С.А. Курилович, Ю.П. Никитин // Атеросклероз .— 2015 .— №1 .— С. 74-80 .— URL: https://rucont.ru/efd/355877 (дата обращения: 16.09.2021)

Автор: Решетников

В обзоре представлены данные изучения ассоциации инфекций пародонта с сердечнососудистыми заболеваниями. Показаны результаты исследований, проведенных в последние полтора десятилетия, включая систематические обзоры и метаанализы. Имеются некоторые доказательства влияния инфекционной патологии полости рта (кариес и его осложнения, воспаление пародонта) на возникновение и прогрессирование атеросклеротического процесса. Важным мероприятием для профилактики сердечно-сосудистых заболеваний может быть адекватная гигиена полости рта.

Т. 11, № 1 gingivalis – 22 %, Prevotella intermedia – 26 %. <...> на наличие Actinobacillus actinomycetemcomitans, Bacteroides forsythus, Porphyromonas gingivalis и Prevotella <...> Патогены пародонта (Porphyromonas gingivalis, Aggregatibacter actinomycetencomitans, Prevotella intermedia

22

Зорина, О.А. ГЕНДЕРНЫЙ АНАЛИЗ МИКРОБИОМА ПАРОДОНТАЛЬНЫХ КАРМАНОВ У ПАЦИЕНТОВ С ХРОНИЧЕСКИМ ГЕНЕРАЛИЗОВАННЫМ ПАРОДОНТИТОМ / О.А. Зорина, Н.К. Аймадинова, Д.В. Ребриков // Российский стоматологический журнал .— 2016 .— №1 .— С. 21-24 .— URL: https://rucont.ru/efd/389365 (дата обращения: 16.09.2021)

Автор: Зорина

В ходе качественной оценки уровня представленности бактерий и мРНК защитных факторов человека в смывах пародонтальных карманов с использованием полимеразной цепной реакции (ПЦР) в реальном времени выявлены принципиальные различия между мужчинами и женщинами с хроническим генерализованным пародонтитом (ХГП). Мы продемонстрировали, что уровень представленности транскриптов фактора некроза опухоли (ФНО-альфа), матриксной металлопротеиназы 8 и 9 (ММП8 и ММП9) отличается в тканях пародонта здоровых мужчин, но не у женщин и мужчин с воспалительными заболеваниями пародонта. Это наблюдение коррелирует с новым фактом наиболее крепкой корреляции между гиперколонизацией Porhyromonas gingivalis в тканях пародонта с тяжестью хронического пародонтита у женщин, но не у мужчин.

в ы е с л о в а : пародонт; хронический генерализованный пародонтит; ПЦР; Porphyromonas gingivalis; Prevotella <...> K e y w o r d s : periodontium; chronic periodontitis; PCR; porphyromonas gingivalis; prevotella intermedia <...> анализа основных пародонтопатогенов: Aggregatibacter actinomycetemcomitans, Porhyromonas gingivalis, Prevotella

23

Зверев, В.В. МИКРОБИОТА КИШЕЧНИКА И ЕЕ СВЯЗЬ С ОЖИРЕНИЕМ / В.В. Зверев, О.В. Максимова, В.Б. Гервазиева // Инфекционные болезни .— 2014 .— №3 .— С. 68-78 .— URL: https://rucont.ru/efd/611984 (дата обращения: 16.09.2021)

Автор: Зверев

В обзоре рассмотрены вопросы влияния микробиоты кишечника и вирусных инфекций на развитие ожирения. Как известно, микрофлора желудочно-кишечного тракта выполняет важные функции в организме хозяина и влияет на здоровье в целом. В ряде работ было показано, что у животных с генетически обусловленным ожирением в микробиоте преобладают Firmicutes и снижена численность Bacteroidetes, в то время как на людях были получены противоречивые результаты. Дискуссия относительно соотношения Firmicutes/Bacteroidetes и влияния их на ожирение у людей до сих пор продолжается. Особое внимание уделяется механизмам, связывающим микробиоту кишечника и ожирение. В обзоре продемонстрировано как изменения в питании, в концентрации короткоцепочечных жирных кислот и ЛПС, бариатрическая хирургия влияют на микробиоту кишечника и вес тела. Приведены данные, подтверждающие ассоциацию антител к аденовирусу 36 с ожирением у детей и с тяжелым ожирением у женщин.

В энтеротипе 2 преобладали бактерии рода Prevotella, которые тесно взаимосвязаны с Desulfovibrio. <...> Prevotella и Desulfovibrio, а они, как известно, работают совместно, разрушая мукопротеины. <...> В микробиоте детей из Буркина-Фасо преобладали бактерии из рода Prevotella. <...> Бактерии из рода Xylanibacter, Prevotella, Butyrivibrio и Treponema обнаружены у детей исключительно <...> После операции уровни Bacteroides/Prevotella оказались выше, чем до операции и такими же, как у худых

24

№5 [Вопросы детской диетологии, 2010]

Научно-практический журнал Национального общества диетологов, Общества детских гастроэнтерологов и Международной организации Consensus in Pediatrics. Журнал входит в Международную реферативную базу Scopus и в Перечень ведущих научных журналов и изданий ВАК, в которых должны быть опубликованы основные результаты диссертаций на соискание ученой степени доктора и кандидата наук. Журнал выпускается с 2003 г. и ориентирован на широкую аудиторию медицинских работников, охватывающую педиатров, диетологов, гастроэнтерологов. Журнал публикует оригинальные исследования, обзоры литературы, лекции, методические рекомендации, клинические наблюдения, официальные документы органов управления здравоохранением.

) g-Bfra-F gg-Bfra-R ATAGCCTTTCGAAAGRAAGAT CCAGTATCAACTGCAATTTTA 495 50 T.Matsuki et al. (2002) [4] Prevotella <...> У детей с ВЗК была выявлена более низкая бактериальная плотность B. fragilis и Prevotella и повышенное <...> Однако это количество было схоже с количеством копий нуклеотидных последовательности Prevotella у детей <...> активности (25% случаев) были выявлены самые высокие значения копий нуклеотидных последовательностей Prevotella <...> Для детей с БК характерно более низкое значение B. fragilis (p < 0,05), C. leptum, C. coccoides и Prevotella

Предпросмотр: Вопросы детской диетологии №5 2010.pdf (0,2 Мб)
25

Сравнительная оценка применения токолитических средств при угрожающих и начавшихся преждевременных родах / И.В. Ежова [и др.] // Вопросы гинекологии, акушерства и перинатологии .— 2015 .— №2 .— URL: https://rucont.ru/efd/322603 (дата обращения: 16.09.2021)

Автор: Ежова

Установить длительность пролонгирования бере- менности при проведении токолитической терапии угрожающих преждевременных родов в зависимости от типа действующего вещества (атозибан/трактоцил/, гексо- преналин, нифедипин), а также оценить побочные эффекты при их применении.

., Prevotella spp., Leptotrichia/Sneathia, BVAB1, BVAB2, BVAB3, 16S рРНК. <...> Наиболее часто выделяли следующие формы L. iners (45% UGT, 61% vagina), Prevotella spp. (33% UGT, 76%

26

№6 [Вестник Российской академии медицинских наук, 2015]

Журнал входит в Перечень ведущих научных журналов и изданий ВАК, в которых должны быть опубликованы основные результаты диссертаций на соискание ученой степени кандидата и доктора наук.

характеризуется более выраженным присутствием Bifidobacterium longum, Prevotella nanceiensis, Neisseria <...> melaninogenica and genus Selenomonas, Granulicatella и Gemella, and decrease of Prevotella nigrescens <...> характеризуются более выраженным присутствием Bifidobacterium longum, Prevotella nanceiensis, Neisseria <...> Prevotella nanceiensis sp. nov., isolated from human clinical samples. <...> Chronic obstructive pulmonary disease and asthma associated Proteobacteria, but not commensal Prevotella

Предпросмотр: Вестник Российской академии медицинских наук №6 2015.pdf (0,2 Мб)
27

Коррекция микрофлоры содержимого пародонтального кармана пациентов с хроническим генерализованным пародонтитом при помощи КВЧ-терапии / В.В. Масляков [и др.] // Журнал медико-биологических исследований .— 2018 .— № 1 .— С. 67-76 .— URL: https://rucont.ru/efd/641543 (дата обращения: 16.09.2021)

Автор: Масляков

Целью работы было изучение влияния крайне высоких частот на нормализацию микрофлоры при различных формах хронического генерализованного пародонтита. В исследовании приняли участие 80 больных хроническим генерализованным пародонтитом (средний возраст – 30 лет). Осуществлялось комплексное обследование пациентов, включающее микробиологический анализ содержимого парадонтального кармана. Проведенное исследование позволило установить, что в патогенезе развития пародонтита легкой степени значительную роль играют представители стабилизирующей микрофлоры и агрессивной части стабилизирующей микрофлоры, а при пародонтите средней степени тяжести – агрессивной части стабилизирующей микрофлоры. Для улучшения результатов лечения и коррекции микрофлоры полости рта было предложено использовать терапию крайне высокими частотами, направленными на биологически активные точки кожи лица, в количестве 10 сеансов (по ранее разработанной методике). Воздействие этих частот приводило к стабилизации микрофлоры у пациентов со средней тяжестью пародонтита на 7-е сутки терапии: представители стабилизирующей микрофлоры составили 55 %, агрессивная часть стабилизирующей микрофлоры – 40 %, пародонтогены 1-го типа – 5 %. В группе без применения крайне высоких частот стабилизирующая микрофлора составила 35 %, агрессивная часть стабилизирующей микрофлоры – 45 %, пародонтогены 1-го типа – 12 % и пародонтогены 2-го типа – 8 %. При этом общее микробное число в основной группе (с воздействием крайне высоких частот) уменьшилось с 13,4±1,6 до 9,4±1,3, а в группе сравнения – лишь до 11,1±1,6. У пациентов с легким течением улучшения отмечены уже на 5-е сутки терапии: количество стабилизирующей микрофлоры увеличилось до 75 %, агрессивная часть стабилизирующей микрофлоры составила 21 %, а представители пародонтогенов 1-го типа – 4 % (в группе сравнения количество микроорганизмов составило 50, 36 и 14 % соответственно); общее микробное число не изменилось – 9,23±1,2. Таким образом, применение терапии крайне высокими частотами в комплекс- ном лечении хронического генерализованного пародонтита приводит к более быстрому восстановлению микрофлоры полости рта.

.; кроме того, были определены парадонтогены 1-го (Prevotella intermedia, Bacteroides forsithus, Treponema <...> Fusobacterium spp. 16±0,3 15±0,2 8±0,2* 8±0,2* 7±0,2* Enbacterium spp. 4±0,3 4±0,3 2±0,1 2±0,1 2±0,1 Prevotella <...> Fusobacterium spp. 20±0,3 20±0,3 17±0,2* 13±0,2* 10±0,2* Enbacterium spp. 9±0,3 9±0,3 7±0,3* 8±0,1 2±0,1* Prevotella <...> accounted for 55 %, the aggressive part of the stabilizing microbiota, for 40 %, and type 1 pathogens (Prevotella

28

№2 [Международный вестник ветеринарии, 2013]

В журнале публикуются статьи, посвященные ветеринарной медицине, зоотехнии, химии, биологии, биологической химии, физиологии.

микроорганизмов, тесно связанных с деструктивными последствиями пародонта: Porphyromonas gingivalis, Prevotella <...> большинство штаммов Staphilococcus wameri (81%), Streptococcus spp. (50%), Fusobacterium spp. (67%), Prevotella <...> Штаммы Staphilococcus aureus (90%), Porphyromonas gingivalis (77%), Prevotella intermedia (75%), Fusobacterium <...> Streptococcus spp. 104-108 6 12 Enterobacterium spp. 105-107 12 24 Облигатноанаэробные микроорганизмы Prevotella <...> Staphilococcus wameri Streptococcus spp. 1 (10 %) 105 Enterobacterium spp. 4 (40 %) 31×07 1 (5 %) 105 Prevotella

Предпросмотр: Международный вестник ветеринарии №2 2013.pdf (0,9 Мб)
29

СОСТОЯНИЕ МИКРОФЛОРЫ ПОЛОСТИ НОСА ПРИ ПОЛИПОЗНОМ РИНОСИНУСИТЕ / А.М. Мельник [и др.] // Российская оториноларингология .— 2017 .— №1 .— С. 73-82 .— URL: https://rucont.ru/efd/596010 (дата обращения: 16.09.2021)

Автор: Мельник

Хронический полипозный риносинусит является в настоящее время одним из распространенных заболеваний. Так, показатель обращаемости по поводу полипозных риносинуситов составляет от 3,7 до 5,8 на 10 000 человек

Гептадеценовая Mycobacterium, Candida albicans 27 i17:0 Изогептадекановая Bacillus, Propionibacterium, Prevotella <...> jensenii 28 26 Peptostreptococcus anaerobius 18623 72 27 Peptostreptococcus anaerobius 17642 367 28 Prevotella <...> К ним относятся клостридии группы C. ramosum, Helicobacter, C. perfringens, Prevotella, Bacteroides fragilis

30

№3 [Кардиоваскулярная терапия и профилактика , 2017]

Научно-практический рецензируемый журнал. Главный редактор — академик РАН, профессор Оганов Р.Г. Журнал публикует научные статьи по вопросам первичной и вторичной профилактики сердечно-сосудистых заболеваний с помощью различных методов лечения, лекции кардиологов, оригинальные статьи, дискуссии, клинические обзоры и обзоры литературы, рекомендации ВНОК, переводы международных рекомендаций и другую информацию для врачей. Каждый номер журнала формируется ответственным редактором — одним из ведущих специалистов в области кардиологии. Начиная с 2007 года, журнал включен в следующие индексы цитирования: Российский индекс цитирования, Scopus; зарегистрирован в Клубе главных редакторов научных журналов Европейского общества кардиологов. Включен в перечень изданий, рекомендованных для публикации статей, содержащих материалы диссертаций (ВАК).

(все обследованные, n=92) 0,5661 0,1230 4,6027 <0,001 Prevotella САД ≥140 мм рт.ст. <...> Бактерии родов Serratia и Prevotella в большей степени были представлены среди участников с ожирением <...> Представленность бактерий рода Prevotella снижалась с возрастом. <...> (все обследованные, n=92) 0,5661 0,1230 4,6027 <0,001 Prevotella САД ≥140 мм рт.ст. <...> Представленность бактерий рода Prevotella снижалась с возрастом.

Предпросмотр: Кардиоваскулярная терапия и профилактика №3 2017 (1).pdf (0,2 Мб)
31

№5 [Журнал микробиологии, эпидемиологии и иммунобиологии, 2017]

Рецензируемый «Журнал микробиологии, эпидемиологии и иммунобиологии» - «Žurnal mikrobiologii, èpidemiologii i immunobiologii» (parallel names на английском языке: «Journal of Microbiology, Epidemiology and Immunobiology»; параллельное название на русском языке: «ЖМЭИ» является одним из старейших (издается с 1924 г. отечественных журналов, публикующих труды отечественных и зарубежных исследователей в области эпидемиологии инфекционных, аллергических, аутоиммунных и онкологических заболеваний; структурной биологии, физиологии, биохимии, генетики, экологии микроорганизмов, вирусов, а также прионов; вакционологии и вакционпрофилактики; разработки новых препаратов для лечения инфекционных, аллергических, аутоиммунных заболеваний и иммунодефицитов. В журнале публикуются оригинальные статьи, обзоры, лекции, краткие сообщения, рецензии ведущих отечественных и зарубежных специалистов, а также материалы конференций, решения государственных органов.

Prevotella intermedia являются грамотрицательными, неподвижными, палоч­ ковидными бактериями, хорош о <...> Это может отражаться на разном распределении Р. gingivalis и Prevotella spp. в ротовой по­ лости. <...> Р. gingivalis не утилизируют сахара, Prevotella обладают сахаролитической способностью. <...> К ним относят гингипаины R и К Р. gingivalis, цистеиновые протеазы Prevotella spp. <...> , Prevotella nigrescens and Porphyromonas gingivalis.

Предпросмотр: Журнал микробиологии, эпидемиологии и иммунобиологии №5 2017.pdf (0,1 Мб)
32

№3 [Клиническая лабораторная диагностика, 2015]

Основан в 1955 г. Главный редактор – Титов Владимир Николаевич, доктор медицинских наук, профессор, заведующий лабораторией клинической биохимии липидного обмена ФБУН «Российский кардиологический научно-производственный комплекс» Минздрава России. Журнал издается как ежемесячное профессиональное научно-практическое издание с 1955 г. (до 1992 г. под названием «Лабораторное дело»). На протяжении многих лет журнал был основным источником научной и практической информации для сотрудников клинико-диагностических лабораторий и играл роль стимула совершенствования лабораторного обеспечения медицинской помощи. Журнал публикует научные и практические материалы, подготовленные сотрудниками научных, образовательных и лечебных учреждений России и зарубежных стран: оригинальные статьи, обзоры литературы, лекции видных специалистов разных дисциплин лабораторной медицины, описания сложных клинико-диагностических случаев заболеваний, информации о научно-практических мероприятиях, дискуссии между сторонниками разных подходов к решению актуальных проблем, ответы ученых и организаторов здравоохранения на насущные вопросы практиков лабораторного дела. Осуществляет публикацию переводов статей зарубежных авторов, представляющих наибольший научно-практический интерес для специалистов в нашей стране и опубликованных в профессиональной научной литературе за рубежом(в частности, в журнале «Clinical Chemistry», с которым заключено соответствующее соглашение).

Для ДНК G. vaginalis, Prevotella spp., Veillonella spp., Anaerococcus spp. и Atopobium vaginae считали <...> Следующими по частоте встречаемости были бактерии рода Prevotella, представленные как минимум 5 видами <...> В наименьшей степени это касалось G.vaginalis, Prevotella spp., Anaerococcus spp. и Veillonellaсeae, <...> Для наиболее часто встречающихся УПБ (G. vaginalis и prevotella spp.) отмечена положительная корреляция <...> Несмотря на то что G. vaginalis и Prevotella spp., как правило, являются преобладающими видами в случае

Предпросмотр: Клиническая лабораторная диагностика №3 2015.pdf (8,3 Мб)
33

№1 [Вопросы курортологии, физиотерапии и лечебной физической культуры, 2019]

oralis 27 8 8 6 5 Prevotella intermedia 22 4 5 6 7 Fusobacterium spp. 87 20 22 23 22 Enterobacter spp <...> Prevotella oralis 4,3±0,3 Н.о. Н.о. Prevotella intermedia 4±0,5* Н.о. Н.о. <...> Prevotella intermedia 4,5±0,2 Н.о. Н.о. Fusobacterium spp. 4,9±0,5 Н.о. Н.о. <...> Prevotella oralis 4±0,2 Н.о. Н.о. Prevotella intermedia 4,3±0,3 Н.о. Н.о. <...> Prevotella intermedia 4,3±0,2 Н.о. Н.о. Fusobacterium spp. 4,7±0,5 Н.о. Н.о.

Предпросмотр: Вопросы курортологии, физиотерапии и лечебной физической культуры №1 2019.pdf (0,2 Мб)
34

МОЛЕКУЛЯРНАЯ ХАРАКТЕРИСТИКА МУЛЬТИРЕЗИСТЕНТНЫХ ШТАММОВ MYCOBACTERIUM TUBERCULOSIS, ВЫДЕЛЕННЫХ НА СЕВЕРО-ЗАПАДЕ РОССИИ / А.А. Вязовая [и др.] // Молекулярная генетика, микробиология и вирусология .— 2016 .— №1 .— С. 32-35 .— URL: https://rucont.ru/efd/399112 (дата обращения: 16.09.2021)

Автор: Вязовая

Целью исследования являлось получение генотипической характеристики мультирезистентных (т. е. устойчивых, по крайней мере, к рифампицину и изониазиду) штаммов Mycobacterium tuberculosis, выделенных в 2011–2012 гг. от больных туберкулезом на северо-западе России. Сполиготипирование 195 штаммов M. tuberculosis выявило их принадлежность к генетическим семействам Beijing (n = 162), LAM (n = 15), H3/URAL (n = 14), а также T, Haarlem и X. Среди 14 сполиготипов преобладали SIT1 (Beijing), SIT42 (LAM) и SIT262 (H3/URAL). Независимо от генотипа все изученные штаммы M. tuberculosis были устойчивы к стрептомицину. Мультирезистентность включала устойчивость к этионамиду (56%), амикацину (31%), канамицину (40%) и капреомицину (33%). Доля устойчивых к этамбутолу штаммов Beijing и non-Beijing составляла 71% (n = 115) и 42% (n = 14) (p < 0,05) соответственно. Среди мультирезистентных штаммов M. tuberculosis на северо-западе России продолжают доминировать представители генетического семейства Beijing (83%).

forsythensis and t. denticola (but not Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, and Prevotella <...> gastritis, real-time PCR, dentoflor, Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Prevotella

35

Чередниченко, Ю. МИКРОБИОМ, МИКРОБИОТА ЧТО НОВОГО? / Ю. Чередниченко // Медицинский совет .— 2016 .— №16 .— С. 96-101 .— URL: https://rucont.ru/efd/512379 (дата обращения: 16.09.2021)

Автор: Чередниченко Юлия

Последнее десятилетие в области изучения микрофлоры человека открыло во всем многообразии удивительный и густонаселенный мир микроорганизмов. Сегодня ученые считают устаревшим термин «микрофлора», предлагая более широкое понятие под названием «микробиом». Мы обратились к профессору, заведующей кафедрой педиатрии ГБОУ ВПО РМАНПО МЗ РФ, главному педиатру ЦАО Ирине Николаевне Захаровой с просьбой рассказать о новых тенденциях в области изучения микробиома и его влиянии на человека

Bacteriodes является доминирующим у первого энтеротипа, Prevotella преобладает у второго энтеротипа, <...> Prevotella в процессе жизнедеятельности разрушает защитный слизистый покров, что, вероятно, предрасполагает

36

№1 [Российский стоматологический журнал, 2016]

Основан в 1997 г. Главный редактор журнала - Олесова Валентина Николаевна - профессор, заведующая кафедрой имплантологии и ортопедической стоматологии ИПК ФМБА России, главный стоматолог ФМБА, президент Российской Ассоциации стоматологической имплантологии. На страницах журнала освещаются актуальные вопросы стоматологии, неврологии, нейростоматологии, этиологии, клиники, дифференциальной диагностики, лечения и профилактики заболеваний в области лица и полости рта, имплантологии. Наряду с оригинальными статьями, лекциями и обзорами публикуются клинические обзоры диагностически трудных случаев. Большое внимание уделяется вопросам неотложной терапии, редко встречающимся заболеваниям. В помощь практическому врачу публикуются сведения о новом стоматологическом оборудовании и лекарственных средствах. В журнале имеется рубрика "Интернет для стоматолога", печатаются статьи по проблемам образования и организации стоматологической помощи.

5 пародонтопатогенных бактерий: Aggregatibacter actinomycetemcomitans , Porphyromonas gingivalis , Prevotella <...> Высокий бактерицидный эффект против пигментообразующих бактерий, таких как Porphyromonas gingivalis, Prevotella <...> в ы е с л о в а : пародонт; хронический генерализованный пародонтит; ПЦР; Porphyromonas gingivalis; Prevotella <...> K e y w o r d s : periodontium; chronic periodontitis; PCR; porphyromonas gingivalis; prevotella intermedia <...> анализа основных пародонтопатогенов: Aggregatibacter actinomycetemcomitans, Porhyromonas gingivalis, Prevotella

Предпросмотр: Российский стоматологический журнал №1 2016.pdf (0,9 Мб)
37

№1 [Клиническая лабораторная диагностика, 2020]

Основан в 1955 г. Главный редактор – Титов Владимир Николаевич, доктор медицинских наук, профессор, заведующий лабораторией клинической биохимии липидного обмена ФБУН «Российский кардиологический научно-производственный комплекс» Минздрава России. Журнал издается как ежемесячное профессиональное научно-практическое издание с 1955 г. (до 1992 г. под названием «Лабораторное дело»). На протяжении многих лет журнал был основным источником научной и практической информации для сотрудников клинико-диагностических лабораторий и играл роль стимула совершенствования лабораторного обеспечения медицинской помощи. Журнал публикует научные и практические материалы, подготовленные сотрудниками научных, образовательных и лечебных учреждений России и зарубежных стран: оригинальные статьи, обзоры литературы, лекции видных специалистов разных дисциплин лабораторной медицины, описания сложных клинико-диагностических случаев заболеваний, информации о научно-практических мероприятиях, дискуссии между сторонниками разных подходов к решению актуальных проблем, ответы ученых и организаторов здравоохранения на насущные вопросы практиков лабораторного дела. Осуществляет публикацию переводов статей зарубежных авторов, представляющих наибольший научно-практический интерес для специалистов в нашей стране и опубликованных в профессиональной научной литературе за рубежом(в частности, в журнале «Clinical Chemistry», с которым заключено соответствующее соглашение).

Prevotella spp.выделяются от БВ-позитивных женщин в 44% случаев [24]. <...> Культуральный лизат Prevotella bivia содержит более высокую концентрацию ЛПС (10713,0±306,6 EU/мл) в <...> У больных данной патологией встречаются в большом разнообразии и другие микроорганизмы: Prevotella, Neisseria <...> Менее чем в 8% обнаруживались Peptostreptococcus spp., Neisseria spp., Prevotella spp., Citrobacter spp <...> В количестве больше 4 lg КОЕ/г выделены Staphylococcus spp., Streptococcus spp., Bacteroides spp., Prevotella

Предпросмотр: Клиническая лабораторная диагностика №1 2020.pdf (1,0 Мб)
38

№1 [Стоматология. Эстетика. Инновации, 2017]

Международный рецензируемый научно-практический журнал для стоматологов различных специальностей (терапевтов, периодонтологов, гигиенистов, хирургов, имплантологов, челюстно-лицевых хирургов, ортопедов, ортодонтов, детских стоматологов) и врачей смежных специальностей. Публикует оригинальные исследования, обзоры в сфере новейших достижений отечественной и мировой науки в области стоматологии.

У всех детей с тяжелой формой идентифицируют Porphyromonas gingivalis, Prevotella intermedia, Bacteroides <...> All children with severe identify Porphyromonas gingivalis, Prevotella intermedia, Bacteroides forsithus <...> У всіх дітей з важкою формою ідентифікують Porphyromonas gingivalis, Prevotella intermedia, Bacteroides <...> У всех детей с тяжелой формой идентифицировали Porphyromonas gingivalis, Prevotella intermedia, Bacteroides <...> У всех детей с тяжелой формой идентифицируют Porphyromonas gingivalis, Prevotella intermedia, Bacteroides

Предпросмотр: Стоматология. Эстетика. Инновации №1 2017 (1).pdf (0,3 Мб)
39

Котина, Е. Кто лучший? / Е. Котина // Химия и жизнь ХХI век .— 2012 .— №2 .— С. 3-7 .— URL: https://rucont.ru/efd/249362 (дата обращения: 16.09.2021)

Автор: Котина
М.: ПРОМЕДИА

О наиболее выдающихся научных достижениях прошлого года.

Оказалось, что микробиомы можно разделить на три группы, или три энтеротипа (их назвали Bacteroides, Prevotella <...> Например, группа Bacteroides обычно селится внутри любителей мясных продуктов, Prevotella предпочитает

40

ХРОМАТО-МАСС-СПЕКТРОМЕТРИЧЕСКОЕ ИССЛЕДОВАНИЕ МИКРОБНЫХ ЖИРНЫХ КИСЛОТ В БИОЛОГИЧЕСКИХ ЖИДКОСТЯХ ЧЕЛОВЕКА И ИХ КЛИНИЧЕСКАЯ ЗНАЧИМОСТЬ / А.Г. Платонова [и др.] // Клиническая лабораторная диагностика .— 2015 .— №12 .— С. 48-57 .— URL: https://rucont.ru/efd/565473 (дата обращения: 16.09.2021)

Автор: Платонова

Метод масс-спектрометрии микробных маркеров (МСММ) известен 20 лет. Он описан в ряде научных публикаций, диссертациях и методической литературе, прошел регистрацию в Росздравнадзоре и разрешен к применению в качестве новой медицинской технологии в медицинских учреждениях на территории Российской Федерации (“Оценка микроэкологического статуса человека методом хромато-масс-спектрометрии”, разрешение ФС № 2010/038 от 24.02.10). Метод МСММ только начал формироваться как инструмент клинического рутинного анализа и мониторинга микроэкологического статуса, инфекции и дисбиозов в клинической и амбулаторной практике. Описание технологии МСММ в таком аспекте требует иного, чем было сделано ранее, подхода к введению клинических лаборантов и врачей в метод. Подробно дается обоснование видовой специфичности состава жирных кислот и (жирных) альдегидов клеточной стенки микроорганизмов как основы их видовой дифференциации в чистой культуре. Объясняется выбор молекулярных маркеров для их детектирования в крови и другом клиническом материале с целью дальнейшей реконструкции состава микробного сообщества (микроэкологии) человека по крови или расчет состава микст-инфекции в органах по материалу из очага воспаления – моче, ликвору, мокроте, экссудату, дренажу и аналогичным пробам, содержащим химическую информацию о микробах

Это стафилококки, виды Butirivibrio, Bacillus, Prevotella, Propionibacterium, Corinebacterium, Bacteroides <...> Гептадеценовая Mycobacterium, Candida albicans 29 i17:0 Изогептадекановая Bacillus, Propionibacterium, Prevotella <...> Flavobacterium, Bacteroides melaninogenicus, Prevotella 72 2hi15 2-Гидроксиизопентадекановая рр.

41

ХРОМАТО-МАСС-СПЕКТРОМЕТРИЧЕСКОЕ ИССЛЕДОВАНИЕ МИКРОБНЫХ ЖИРНЫХ КИСЛОТ В БИОЛОГИЧЕСКИХ ЖИДКОСТЯХ ЧЕЛОВЕКА И ИХ КЛИНИЧЕСКАЯ ЗНАЧИМОСТЬ / А.Г. Платонова [и др.] // Клиническая лабораторная диагностика .— 2015 .— №12 .— С. 48-57 .— URL: https://rucont.ru/efd/395757 (дата обращения: 16.09.2021)

Автор: Платонова

Метод масс-спектрометрии микробных маркеров (МСММ) известен 20 лет. Он описан в ряде научных публикаций, диссертациях и методической литературе, прошел регистрацию в Росздравнадзоре и разрешен к применению в качестве новой медицинской технологии в медицинских учреждениях на территории Российской Федерации (“Оценка микроэкологического статуса человека методом хромато-масс-спектрометрии”, разрешение ФС № 2010/038 от 24.02.10). Метод МСММ только начал формироваться как инструмент клинического рутинного анализа и мониторинга микроэкологического статуса, инфекции и дисбиозов в клинической и амбулаторной практике. Описание технологии МСММ в таком аспекте требует иного, чем было сделано ранее, подхода к введению клинических лаборантов и врачей в метод. Подробно дается обоснование видовой специфичности состава жирных кислот и (жирных) альдегидов клеточной стенки микроорганизмов как основы их видовой дифференциации в чистой культуре. Объясняется выбор молекулярных маркеров для их детектирования в крови и другом клиническом материале с целью дальнейшей реконструкции состава микробного сообщества (микроэкологии) человека по крови или расчет состава микст-инфекции в органах по материалу из очага воспаления – моче, ликвору, мокроте, экссудату, дренажу и аналогичным пробам, содержащим химическую информацию о микробах.

Это стафилококки, виды Butirivibrio, Bacillus, Prevotella, Propionibacterium, Corinebacterium, Bacteroides <...> Гептадеценовая Mycobacterium, Candida albicans 29 i17:0 Изогептадекановая Bacillus, Propionibacterium, Prevotella <...> Flavobacterium, Bacteroides melaninogenicus, Prevotella 72 2hi15 2-Гидроксиизопентадекановая рр.

42

ОСОБЕННОСТИ ВОСПАЛИТЕЛЬНОГО ПРОЦЕССА РЕПРОДУКТИВНЫХ ОРГАНОВ САМОК МЫШЕЙ ЛИНИИ C57Bl/6 ПРИ ЭКСПЕРИМЕНТАЛЬНОМ ТУБЕРКУЛЕЗЕ / Г.Т. Сухих [и др.] // Бюллетень экспериментальной биологии и медицины .— 2015 .— №12 .— С. 71-75 .— URL: https://rucont.ru/efd/366242 (дата обращения: 16.09.2021)

Автор: Сухих

Внутривенное инфицирование самок мышей линии C57Bl/6 M. tuberculosis Н37Rv приводит не только к поражению легких, но и к распространению туберкулезной инфекции в органы брюшной полости и малого таза. M. tuberculosis были обнаружены через 14, 35, 90 сут после инфицирования в легких, селезенке и через 90 сут в маточных рогах. При морфологическом исследовании органов самок мы наблюдали последовательное развитие экссудативно-некротического туберкулеза легких, острого и хронического воспаления неспецифического характера в половых органах (влагалище, матке, маточных рогах). Воспалительный процесс в половых органах сопровождался развитием анаэробного дисбиоза, наиболее выраженного через 35 сут после инфицирования. Противотуберкулезная терапия приводила к снижению количества M. tuberculosis в легких и селезенке через 60 и 90 сут, абациллированию маточных рогов, купированию неспецифического воспаления в половых органах самок мышей, восстановлению баланса аэробно-анаэробной флоры, а также развитию кандидоза слизистых урогенитального тракта.

., Prevotella bivia/Porphyromo� nas, Peptostreptococcus spp., Gardnerella vaginalis (рис. 1), через 90 <...> I — Enterobacterium; II — Prevotella; III — Eubacterium; IV — Leptotrix; V — Lachnobacterial; VI — Peptostrep <...> I — Enterobacterium; II — Staphilo> coccus spp.; III — Prevotella; IV — Eubacterium; V — Leptotrix; VI

43

№5 [Вопросы детской диетологии, 2019]

Научно-практический журнал Национального общества диетологов, Общества детских гастроэнтерологов и Международной организации Consensus in Pediatrics. Журнал входит в Международную реферативную базу Scopus и в Перечень ведущих научных журналов и изданий ВАК, в которых должны быть опубликованы основные результаты диссертаций на соискание ученой степени доктора и кандидата наук. Журнал выпускается с 2003 г. и ориентирован на широкую аудиторию медицинских работников, охватывающую педиатров, диетологов, гастроэнтерологов. Журнал публикует оригинальные исследования, обзоры литературы, лекции, методические рекомендации, клинические наблюдения, официальные документы органов управления здравоохранением.

в отличие от НР(+), в желудке обитает большое количество Eubacterium cylindroides и различных видов Prevotella <...> . pylori людей количество Proteobacteria было небольшим, но присутствовало значительно больше видов Prevotella <...> Больные с атрофическим гастритом имели более высокий уровень Streptococcus и снижение Prevotella [42] <...> Fiber-utilizing capacity varies in Prevotella-versus Bacteroides-dominated gut microbiota. <...> Fiber-utilizing capacity varies in Prevotella-versus Bacteroides-dominated gut microbiota.

Предпросмотр: Вопросы детской диетологии №5 2019.pdf (0,4 Мб)
44

Человек и его микробиота: причины и следствия изменений взаимоотношений (взгляд на проблему) / Н.В. Гончар [и др.] // Вопросы детской диетологии .— 2015 .— №5 .— С. 41-50 .— URL: https://rucont.ru/efd/347361 (дата обращения: 16.09.2021)

Автор: Гончар

В обзоре обобщены современные представления о взаимодействии микробиоты и человека, рассмотрены этапы становления микробиоты в онтогенезе и ее роль в формировании адаптивного иммунитета. Современные подходы к изучению микробиоты и ее функций способствуют раскрытию отдельных механизмов взаимного сосуществования и формируют перспективу к пониманию дисбаланса, лежащего в основе развития патологических состояний и различных заболеваний. Изложенный материал базируется на данных научных публикаций отечественных и зарубежных авторов последних лет.

выделить 3 базовых энтеротипа микробиома кишечника в зависимос­ ти от преобладания в нем Bacteroides, Prevotella <...> ческие явления в виде снижения количества лактобацилл и высокой пролиферации анаэробов (Peptoniphilus, Prevotella <...> естественным путем, соответствует вагинальной микро­ биоте матери и представлена Lactobacillus spp., Prevotella

45

Рищук, С.В. Дисбиоз влагалища: новый взгляд на проблему / С.В. Рищук // Вопросы гинекологии, акушерства и перинатологии .— 2016 .— №3 .— С. 55-64 .— URL: https://rucont.ru/efd/453821 (дата обращения: 16.09.2021)

Автор: Рищук

В настоящей статье представлены терминология и современные взгляды, касающиеся микробиоты влагалища. Дана характеристика эндогенных и экзогенных триггерных факторов, приводящих к нарушению вагинального микробиоценоза. Рассмотрены механизмы эндокринной и иммунной регуляции эндогенной микробиоты влагалища, а также взаимоотношения эндогенной микрофлоры и возбудителей экзогенных половых инфекций. Дана характеристика разновидностей дисбиоза влагалища, этапов развития эндогенной инфекции и её клинических проявлений. Представлены диагностические и лечебные подходы.

14 +/– Propionibacterium spp. 0–14/25 + Bifidobacterium spp. 5–15/12 – Clostridium spp. 5–18/10–25 + Prevotella <...> Mobiluncus curtisii Prevotella bivia Чи сл о ж ен щ ин 41 23 45 13 33 4 39 31 26 22 Рис. 3.

46

Краткое введение в микробиологию полости рта

Автор: Sun Weibin
Издательство Юго-Восточного университета

Эта книга основана на общих инфекционных заболеваниях полости рта и знакомит с составом и распределением микроорганизмов полости рта и различными экологическими факторами, влияющими на микроорганизмы полости рта, характеристиками и патогенностью зубного налета и предполагаемыми патогенными бактериями, связанными с этим заболеванием. Основное содержание включает в себя: экосистему полости рта, зубной налет, микробиологию кариеса зубов, микробиологию пародонтита пульпы зубов, микробиологию заболеваний пародонта, микробиологию слизистых оболочек, микробиологию челюстно-лицевой инфекции, а также выделение и идентификацию микроорганизмов полости рта, основные знания противоинфекционной химиотерапии. < / p>

(2) 普雷沃菌属(Prevotella) 多数对青霉素、头孢菌素、卡那霉素和万古霉 素耐药,对甲硝唑、利福平和新霉素敏感。 <...> 中间普雷沃菌(Prevotella intermedia) 和产黑色素普雷沃菌(Prevotella melaninogenica)是革兰阴性无芽孢专性厌氧解 糖杆菌,在感染根管临床样本中最常检出。 <...> 颊普雷沃菌(Prevotella buccae)具有 高度免疫原性的结晶蛋白质表层,内毒素活性低,但诱发变态反应作用较强。 <...> 中间普雷沃菌(Prevotella intermedia) 和产黑色素普雷沃菌(Prevotella melaninogenica)是革兰阴性无芽孢专性厌氧解 糖杆菌,在感染根管临床样本中最常检出。 <...> 颊普雷沃菌(Prevotella buccae)具有 高度免疫原性的结晶蛋白质表层,内毒素活性低,但诱发变态反应作用较强。

Предпросмотр: Краткое введение в микробиологию полости рта.pdf (3,1 Мб)
47

ИССЛЕДОВАНИЕ КОЛИЧЕСТВЕННОГО И КАЧЕСТВЕННОГО СОСТАВА МИКРОФЛОРЫ ВНУТРЕННЕГО ИНТЕРФЕЙСА ДЕНТАЛЬНОГО ИМПЛАНТАТА / С.Н. Хвостов [и др.] // Здоровье и образование в XXI веке. Журнал научных статей .— 2015 .— №4 .— С. 127-129 .— URL: https://rucont.ru/efd/583279 (дата обращения: 16.09.2021)

Автор: Хвостов

Исследование посвящено изучению бактериальной контаминации внутреннего интерфейса дентального имплантата, ее количественному и качественному составу. Авторами данного исследования выдвигается гипотеза о возможности проникновения бактерий из внутреннего интерфейса имплантата через зазор в области сочленения имплантат-супраструктура и их влиянии на воспалительные реакции в тканях периимплантатной зоны и процесс остеоинтеграции

факультативно-анаэробной и облигатно-анаэробной флоры (Staphylococcus aureus, Streptococcus haemolyticus, Prevotella <...> микроорганизмов, характерные для воспалительных процессов заболеваний пародонта — гингивита и пародонтита (Prevotella

48

УРОГЕНИТАЛЬНАЯ ЭНДОГЕННАЯ БАКТЕРИАЛЬНАЯ ИНФЕКЦИЯ И СИСТЕМНАЯ ЭНЗИМОТЕРАПИЯ / С.В. Рищук [и др.] // Медицинский совет .— 2016 .— №17 .— С. 130-138 .— URL: https://rucont.ru/efd/545061 (дата обращения: 16.09.2021)

Автор: Рищук

В настоящей статье представлены терминология и современные взгляды, касающиеся формирования дисбиоза влагалища и урогенитальной эндогенной инфекции. Дана характеристика эндогенных и экзогенных триггерных факторов, приводящих к нарушению вагинального микробиоценоза. Рассмотрены механизмы возникновения некоторой акушерской патологии при данном инфекционном процессе. Представлены диагностические и лечебные подходы для коррекции дисбиоза с определением места системной энзимотерапии в комплексном лечении данной патологии

эндогенной микробиоты (табл. 3) наиболее часто встречаются бактерии из родов Gardnerella, Atopobium и Prevotella <...> Mobiluncus Bifidobacteriales Gardnerella Coriobacteriales AtopobiumEggerthella Bacteroidetes Bacteroidales Prevotella

49

Можейко, Л.Ф. Современный взгляд на этиопатогенез, диагностику и лечение дисбиоза влагалища / Л.Ф. Можейко, Н.Н. Рубахова // Репродуктивное здоровье. Восточная Европа .— 2015 .— №2 .— С. 8-13 .— URL: https://rucont.ru/efd/476756 (дата обращения: 16.09.2021)

Автор: Можейко

В статье описаны современные представления о нормоценозе и основные варианты нарушений биоценоза влагалища. Изложены критерии и диагностические подходы к оценке состояния влагалищной экосистемы. Обоснована этапная современная концепция коррекции биоценоза влагалища

лактобактерий, в результате отмечается чрезмерное развитие патогенных микроорганизмов G. vaginalis, Mycoplasma, Prevotella <...> анаэробными бактериями – Streptococcus agalactiae, Esherichia coli (виды Bacteroides, Peptostreptococcus, Prevotella

50

№1 [Молекулярная генетика, микробиология и вирусология, 2016]

Основан в 1983 г. Главный редактор журнала - Костров Сергей Викторович - член-корреспондент РАН, профессор, доктор биологических наук, директор Института молекулярной генетики РАН. Журнал освещает наиболее актуальные теоретические и прикладные проблемы молекулярной генетики про- и эукариотных организмов, молекулярной микробиологии и молекулярной вирусологии. Важную роль журнал отводит исследованиям генетического аппарата микроорганизмов, изысканиям форм генетического обмена, генетического картирования патогенных возбудителей, выяснению строения и функций внехромосомных факторов наследственности и мигрирующих генетических элементов, теоретическим исследованиям механизмов генетической регуляции. Публикует результаты исследований молекулярных и генетических основ эукариотной клетки, функционирования хромосом и хроматина, природы генетических изменений при злокачественном перерождении и ряде наследственных заболеваний. На страницах журнала освещается разработка молекулярных основ вирусологии, в том числе вопросы интеграции вирусных и клеточных геномов, вопросы персистенции.

forsythensis и T. denticola, но не Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis и Prevotella <...> пародонт; гастрит; ПЦРРВ; Дентофлор; Aggregatibacter actinomycetemcomitans; Porphyromonas gingivalis; Prevotella <...> пяти пародонтопатогенных бактерий: Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Prevotella <...> Подвижность Кровоточивость Общая бакт. масса Actinobacillus actinomycetemcomitans Porhpyromonas gingivalis Prevotella <...> gastritis, real-time PCR, dentoflor, Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Prevotella

Предпросмотр: Молекулярная генетика, микробиология и вирусология №1 2016.pdf (0,8 Мб)
Страницы: 1 2 3 ... 12