Национальный цифровой ресурс Руконт - межотраслевая электронная библиотека (ЭБС) на базе технологии Контекстум (всего произведений: 545537)
Консорциум Контекстум Информационная технология сбора цифрового контента
Уважаемые СТУДЕНТЫ и СОТРУДНИКИ ВУЗов, использующие нашу ЭБС. Рекомендуем использовать новую версию сайта.
  Расширенный поиск
Результаты поиска

Нашлось результатов: 276163 (6,23 сек)

Свободный доступ
Ограниченный доступ
Уточняется продление лицензии

I/D ПОЛИМОРФИЗМ ГЕНА АНГИОТЕНЗИНПРЕВРАЩАЮЩЕГО ФЕРМЕНТА У БОЛЬНЫХ ИБС РАЗНОГО ПОЛА И ВОЗРАСТА [Электронный ресурс] / Реброва Т. Ю., [и др.] // Российский кардиологический журнал .— 2014 .— №10 .— Режим доступа: https://rucont.ru/efd/278450

Автор: Реброва Т. Ю.,

Обнаружены гендерные особенности влияния I/D полимор- физма гена ACE на риск развития ИМ. Среди женщин, больных и здоровых, а также разного возраста, не обнаружено достоверных различий в частоте генотипов полиморфизма. Однако выявлены статистически значимые разли- чия в распределении генотипов между здоровыми мужчинами и перенесшими ИМ, а также между мужчинами в возрасте 34-50 лет и 51-79 лет.

77 КАРДИОГЕНЕТИКА I/D ПОЛИМОРФИЗМ ГЕНА АНГИОТЕНЗИНПРЕВРАЩАЮЩЕГО ФЕРМЕНТА У БОЛЬНЫХ ИБС РАЗНОГО ПОЛА И <...> Обнаружены гендерные особенности влияния I/D полиморфизма гена ACE на риск развития ИМ. <...> Известен I/D полиморфизм (rs4340) гена АСЕ, связанный с инсерцией (I) или делецией (D) Alu повтора размером <...> Также группы не отличались по частоте аллелей I и D (χ2=0,004, p=0,949). <...> 51,87 53,85 50,0 49,6 Аллель D 48,13 46,15 50,0 50,4 p1 0,038 0,910 p2 0,858 0,949 ОР D/I 1,081 (ДИ:


Оценка полиморфизма генов липид-транспортной системы и I/D полиморфизма гена ангиотензинпревращающего фермента у больных нестабильной стенокардией узбекской национальности с семейным анамнезом ишемической болезни сердца [Электронный ресурс] / Курбанов [и др.] // Кардиоваскулярная терапия и профилактика .— 2013 .— №2 .— С. 46-51 .— Режим доступа: https://rucont.ru/efd/463578

Автор: Курбанов

Изучить влияние семейного анамнеза ишемической болезни сердца (ИБС) на распределение полиморфизма генов аполипопротеинов (апо) А1, В и Е липид-транспортной системы и I/D полиморфизма гена ангиотензин-превращающего фермента (АПФ) у больных нестабильной стенокардией (НС) узбекской национальности.

I/D полиморфизма гена АПФ. <...> allele of the ACE I/D polymorphism. <...> I/D полиморфизма гена AПФ. <...> Д., … Оценка полиморфизма генов липид-транспортной системы и I/D гена при ИБС… генотип D/D гена АПФ и <...> I/D полиморфизма гена AПФ.


Роль аллельных вариантов генов ангиотензинпревращающего фермента ACE и серотонинового транспортера SLC6A4 в развитии когнитивного дефицита у лиц с метаболическим синдромом [Электронный ресурс] / Зуева [и др.] // Артериальная гипертензия .— 2012 .— №6 .— С. 53-61 .— Режим доступа: https://rucont.ru/efd/347286

Автор: Зуева

Актуальность. Факторы риска сердечно-сосудистых заболеваний играют важную роль в развитии когнитивного дефицита (КД). Цель исследования — определение частот аллельных вариантов, обусловленных полиморфизмом гена ACE I/D (rs4646994), а также полиморфизмами гена SLC6A4 L/S (rs4795541) и A/G (rs25531), у лиц с различной выраженностью метаболического синдрома (МС) и КД. Материалы и методы. Обследованы 55 человек с использованием антропометрии, биохимического анализа крови (глюкоза, липидный спектр), молекулярно-генетического анализа (полимеразная цепная реакция, полиморфизм длин рестрикционных фрагментов) и нейропсихологических тестов («10 слов» по Лурии, «рисование часов» для оценки краткосрочной памяти; FAB — оценка лобной дисфункции; CFQ — оценка субъективных жалоб на нарушение памяти и внимания; HADS — оценка уровня тревоги и депрессии; MMSE — оценка психического статуса). Выводы. Аллельный вариант D гена ACE, а также аллельные варианты S и LG гена SLC6A4 ассоциированы с развитием МС. С развитием КД — снижением параметров краткосрочной памяти — ассоциированы аллельные варианты S и LG гена SLC6A, но не аллельные варианты гена ACE. При этом для реализации в фенотипе неблагоприятных эффектов аллелей S и LG гена SLC6A4 достаточно их гетерозиготного носительства.

Цель исследования — определение частот аллельных вариантов, обусловленных полиморфизмом гена ACE I/D <...> Аллелю I соответствовал фрагмент 490 п.н., аллелю D — 190 п.н. <...> Аллель D неблагоприятно влиял на фенотип (табл. 1), однако мы не обнаружили ассоциаций I/D полиморфизма <...> ), в то же время в контрольной группе частоты аллелей I и D были равны (0,500). <...> No association of angiotensin I converting enzyme I/D polymorphism with domain-specifi c cognitive function


Избирательная эффективность валсартана у больных с гипертрофической кардиомиопатией [Электронный ресурс] / Комиссарова [и др.] // Кардиология в Беларуси .— 2011 .— №4 .— С. 117-127 .— Режим доступа: https://rucont.ru/efd/491702

Автор: Комиссарова

Оценена целесообразность применения валсартана при необструктивной ГКМП. Оценивались клинические данные, показатели ЭхоКГ, суточного мониторирования ЭКГ, исследовался полиморфизм I/D гена АПФ (ACE) на фоне 6-месячной терапии валсартаном в дозе 80 мг в сутки. Выявлен достоверный положительный эффект на фоне лечения валсартаном в плане уменьшения клинической симптоматики, регрессии гипертрофии ЛЖ, уменьшения дисперсии корригированного QT-интервала у носителей аллеля D гена ACE

I/D полиморфизм в гене AСЕ изучали с использованием метода полимеразной цепной реакции (ПЦР). <...> В ходе ряда исследований были получены доказательства влияния I/D полиморфизма гена ACE, кодирующего <...> Рисунок 2 Распределение генотипов I/D-полиморфизма гена АСЕ среди пациентов с необструктивной формой <...> Логично связать такую гетерогенность с I/D полиморфизмом гена ACE. <...> Clinical evidence, EchoCG, ECG daily monitoring and I/D gene polymorphism have been evaluated secondary


Полигенные ассоциации полиморфизма генов ренин-ангиотензин-альдостероновой системы при эссенциальной артериальной гипертензии [Электронный ресурс] / Павлова [и др.] // Артериальная гипертензия .— 2016 .— №3 .— С. 27-36 .— Режим доступа: https://rucont.ru/efd/457063

Автор: Павлова

Цель исследования — провести анализ полигенных ассоциаций полиморфизма М235 Т гена ангиотензиногена (AGT), I/D гена ангиотензинпревращающего фермента (ACE), C3123A гена рецепторов 2-го типа к ангиотензину II (AGTR2) и C344T гена альдостеронсинтазы (CYP11B2) с вероятностью наличия эссенциальной артериальной гипертензии (АГ). Материалы и методы. Обследовано 532 неродственных индивидуума, постоянно проживающих на территории Беларуси и представляющих этнически гомогенную группу, из них 356 пациентов с АГ и 176 здоровых лиц. Проведены оценка клинических данных и молекулярно-генетическое обследование полиморфизма генов ренин-ангиотензин-альдостероновой системы (РААС). Поиск и анализ полигенных ассоциаций производился с использованием программного обеспечения APSampler. Результаты. Получены данные о наличии взаимосвязи сочетанного носительства Т аллеля (М235 Т) гена AGT и Т аллеля (C344T) гена CYP11B2 с вероятностью наличия АГ у женщин в возрасте до 45 лет: отношение шансов (ОШ) = 4,15; 95 % доверительный интервал (ДИ) = 1,90–9,07; р = 0,004. Полигенные ассоциации, характерные для нормотензивных лиц, включали: I аллель (I/D) гена ACE и CC генотип (C3123A) гена AGTR2 (ОШ = 0,58; 95 % ДИ = 0,49–0,68; р = 0,03); I аллель (I/D) гена ACE и ММ генотип (М235 Т) гена AGT у женщин до 45 лет (ОШ = 0,09; 95 % ДИ = 0,01–0,63; р = 0,005); М аллель (М235 Т) гена AGT и CC генотип (C3123A) гена AGTR2 в группе старше 45 лет (ОШ = 0,55; 95 % ДИ = 0,47–0,64; р = 0,03). Выводы. При индивидуальном анализе не было найдено отличий в распределении частот аллелей и генотипов изучаемых генов РААС в группах пациентов с АГ и здоровых лиц. Обнаружены полигенные сочетания полиморфизма генов РААС, частота встречаемости которых значимо различалась в группах пациентов и контроля, что свидетельствует о преимуществах изучения влияния сочетаний генотипов и/или аллелей различных полиморфных локусов на риск развития эссенциальной АГ перед анализом ассоциаций с заболеванием каждого локуса в отдельности.

Полигенные ассоциации, характерные для нормотензивных лиц, включали: I аллель (I/D) гена ACE и CC генотип <...> (C3123A) гена AGTR2 (ОШ = 0,58; 95 % ДИ = 0,49–0,68; р = 0,03); I аллель (I/D) гена ACE и ММ генотип <...> Polygenic associations among normotensives included: I allele (I/D) ACE gene and CC genotype (C3123A) <...> АСЕ rs4646994Alu I/D F: CCCTGCAGGTGTCTGCAGCATGT R: GGATGGCTCTCCCCGCCTTGTCTC I 597 D 319 AGT rs699Met235Thr <...> D II 88 24,7 45 25,6 0,01 ID 175 49,2 93 52,8 0,6 DD 93 26,1 38 21,6 1,3 I 351 49,3 183 52,0 0,7D 361


Полиморфизм генов ренин-ангиотензинальдостероновой системы у детей и подростков с артериальной гипертензией [Электронный ресурс] / Кузьмина, Мутафьян, Ларионова // Артериальная гипертензия .— 2009 .— №4 .— С. 67-72 .— Режим доступа: https://rucont.ru/efd/349724

Автор: Кузьмина

Цель исследования. Изучить распределение аллелей и генотипов полиморфизма I/D по гену ангиотензин-превращающего фермента (АСЕ), полиморфизма M235Т по гену ангиотензиногена (AGT), полиморфизма А1166С по гену рецептора ангиотензина II 1-го типа (AGTR1) в группе детей с артериальной гипертензией (АГ) и в группах сравнения. Материалы и методы. Обследовано 84 пациента с АГ, 146 детей с нормальными значениями артериального давления (АД) и 398 детей, представляющих случайную выборку. Результаты. Выявлено статистически значимое повышение частоты встречаемости аллеля 235Т в группе детей с АГ по сравнению с детьми из группы с нормальными значениями АД. Обнаружено повышение частоты генотипа ТТ в группе детей с АГ по сравнению с распространенностью этого генотипа у детей двух групп сравнения. У девочек с АГ обнаружено достоверное повышение частоты аллеля 235Т и генотипа ТТ гена AGT по сравнению с их частотами у девочек из групп сравнения. Среди мальчиков с АГ выявлено значимое преобладание генотипа ТТ и аллеля 235Т гена AGT по сравнению с мальчиками с нормальными значениями АД. Достоверных различий в распределении аллелей и генотипов полиморфизма I/D гена АСЕ и А1166С гена AGTR1 у детей исследуемых групп не выявлено. Заключение. Необходимы дальнейшие исследования с увеличением объема выборки обследованных детей с АГ, подтвержденной результатами суточного мониторирования АД, для уточнения роли полиморфизма М235Т полиморфизма гена ангиотензиногена в развитии АГ у детей. Ключевые слова: артериальная гипертензия, ренин-ангиотензин-альдостероновая система, генетический полиморфизм.

D гена асе Дети и подростки с АГ I/I/II I/D/DD D/D/DD ММ 3 (4 ��)* ��)*��)* 8 (10 ��) ��)��) 5 (6 ��) <...> I/II I/D/DD D/D/DD ММ 18 (21 ��) ��)��) 27 (32 ��) ��)��) 1 (1 ��) (1 ��)(1 ��) ��)��) МТ 8 (10 ��) � <...> I/II I/D/DD D/D/DD ММ 16 (5 ��) ��)��) 42 (14 ��) ��)��) 26 (9 ��) ��)��) МТ 42 (14 ��) ��)��) 81 (27 <...> D гена асе Дети и подростки с АГ I/I I/D D/D АА 8 (12 ��) ��)��) 18 (28 ��) ��)��) 5 (8 ��) ��)��) АС <...> I I/D D/D АА 9 (17 ��) ��)��) 13 (25 ��) ��)��) 6 (11 ��) ��)��) АС 2 (4 ��) ��)��) 8 (15 ��) ��)��)


Органопротективные эффекты хинаприла: фармакогенетические аспекты [Электронный ресурс] / Сычев, Муслимова // Кардиоваскулярная терапия и профилактика .— 2011 .— №2 .— С. 98-101 .— Режим доступа: https://rucont.ru/efd/463212

Автор: Сычев

В обзоре представлены современные данные об органопротективных эффектах ингибитора ангиотензин-превращающего фермента хинаприла, полученные как в экспериментальных, так и клинических исследованиях, которые зависят от I/D полиморфизма гена ACE. В настоящее время есть основания полагать, что именно хинаприл способен модулировать этот генетический фактор риска, который с большой частотой распространен и среди российских пациентов

Ключевые слова: хинаприл, органопротекция, фармакогенетика, I/D полиморфизм ACE. <...> These effects are dependent on I/D polymorphism of ACE gene. <...> Key words: Quinapril, organo-protection, pharmacogenetics, I/D polymorphism of ACE gene. <...> — I/D полиморфизм. <...> Данные об ассоциации I/D полиморфизма с изменением антигипертензивного и органопротективного действия


Генетические маркеры сердечно-сосудистых факторов риска и артериальной гипертензии в коренной популяции Горной Шории [Электронный ресурс] / Мулерова [и др.] // Артериальная гипертензия .— 2015 .— №3 .— С. 49-57 .— Режим доступа: https://rucont.ru/efd/353394

Автор: Мулерова

Цель исследования — изучить ассоциации полиморфизмов генов ADRA2B, ACE, ADRB1, eNOS и MTHFR с артериальной гипертензией (АГ) и ее факторами риска в коренной популяции Горной Шории. Материалы и методы. Проведено клинико-эпидемиологическое исследование коренного населения труднодоступных районов Горной Шории. Сплошным методом обследовано 395 человек, выборка состояла из взрослого населения (18 лет и старше). Изучены антропометрические данные, показатели липидного спектра крови, полиморфизмы генов ADRB1 (Ser49Gly, A/G, rs1801252) ADRA2B (I/D), ACE (I/D), eNOS (4a/4b) и MTHFR (С677 Т, Ala222Val, rs1801133). Результаты. В коренной популяции Горной Шории средние показатели триглицеридов, индекса атерогенности и холестерина липопротеинов очень низкой плотности были выше у лиц с гомозиготным генотипом DD гена ADRA2B. Шорцы с ожирением в 2,8 раза чаще оказывались носителями аллеля D гена ADRA2B по сравнению с населением с нормальной массой тела. Относительный риск выявления носителей аллеля D гена АСЕ в группе лиц с гиперхолестеринемией в 7,9 раза выше, чем в группе с нормальным уровнем общего холестерина и 11,2 раза выше в группе лиц с гипербетахолестеринемией, чем в группе с нормальным уровнем холестерина липопротеинов низкой плотности. У гомозигот по аллелю А гена ADRB1 относительный риск развития АГ в 1,6 раза выше по сравнению с гомозиготами по аллелю G и гетерозиготами. Выводы. Выявлена связь Ser49Gly полиморфизма гена ADRB1 с индексом атерогенности, I/D полиморфизма гена ADRA2B с уровнем триглицеридов, холестерина липопротеинов очень низкой плотности, индексом атерогенности, I/D полиморфизма гена ACE с уровнем общего холестерина и холестерина липопротеинов низкой плотности. Аллель D гена ADRА2B ассоциирован с ожирением, нарушением распределения жировой ткани. Аллель А гена ADRB1 в популяции шорцев ассоциирован с относительным риском развития АГ.

D), ACE (I/D), eNOS (4a/4b) и MTHFR (С677 Т, Ala222Val, rs1801133). результаты. <...> D), ACE (I/D), eNOS (4a/4b) and MTHFR (C677T, Ala222Val, rs1801133). results. <...> Полиморфизмы генов ADRB1 (Ser49Gly, A/G, rs1801252) ADRA2B (I/D), ACE (I/D), eNOS (4a/4b) и MTHFR (С677 <...> Аллели I и D гена ACE не ассоциированы с относиТаблица 1 вЗаИмОСвяЗь i/d ПОлИмОрФИЗма Гена AdrA2b С ФакТОрамИ <...> , ИА, I/D полиморфизма гена ACE с уровнем ОХС и ХС ЛПНП.



Автор: Архипова

Проведен сравнительный анализ распределения частот генотипов полиморфизма I/D гена ангиотензинпревращающего фермента (АСЕ) и D442G гена белка-переносчика эфиров холестерина (СЕТР) у пациентов пожилого, старческого возраста и долгожителей с ИБС с учетом национальности, возраста и пола. С возрастом наблюдают уменьшение частоты встречаемости генотипа ACE*I/*I и имеется тенденция к повышению частоты генотипа ACE*D/*D. Выявлены половые различия в частоте выявления гомозиготного генотипа ACE*D/*D при сравнительном анализе генотипов АСЕ*D/*D и АСЕ*D/*I. Носители генотипа ACE*D/*D достоверно чаще встречаются среди мужчин, чем среди женщин. В общей группе, особенно в группе якутов, у носителей генотипа ACE*I/*I достоверно чаще наблюдали гипертрофию миокарда левого желудочка, которая четко отражается с помощью ЭКГ признака Соколова–Лайона. При изучении полиморфизма D442G гена СЕТР носители генотипа СЕТР*D/*G достоверно чаще встречаются среди якутов, чем среди лиц некоренной национальности. При сравнении частот генотипов I/D -полиморфизма гена АСЕ получены достоверные различия по индексу массы тела, показателям липидов крови. Сравнение же генотипов CETP*D/*D, CETP*D/*G не дало достоверной связи с факторами риска ИБС

генотипов АСЕ*D/*D и АСЕ*D/*I. <...> Достоверных различий в частоте распределения генотипов АСЕ*D/*D, АСЕ*D/*I, АСЕ*I/*I в группе больных <...> Не обнаружили достоверных различий и в частоте распределения генотипов АСЕ*D/*D, АСЕ*D/*I, АСЕ*I/*I по <...> *D, АСЕ*D/*I, АСЕ*I/*I. <...> *D, ACE*D/*I, ACE*I/*I выявил у носителей генотипа ACE*D/*D достоверно более низкий уровень ХС ЛПВП (



Автор: Рубаненко

Выявить взаимосвязь полиморфизмов генов интерлейкина-6 (IL6, C174G), интерлейкина-10 (IL10, C592A), супероксиддисмутазы (SOD1, G8958A) и ангиотензинпревращающего фермента (ACE, Alu Ins/Del) с послеоперационной фибрилляцией предсердий (ПОФП) при коронарном шунтировании (КШ) у пациентов с ишемической болезнью сердца (ИБС)

d ACE Alu (58,4%). <...> d ACE Alu (58,4%). <...> D ACE Alu. <...> 11 (19,6%) 5 (20,8%) 0,9 I/d 34 (60,8%) 14 (58,4%) 0,84 d 11 (19,6%) 5 (20,8%) 0,9 Отношение шансов аллель <...> связана как гомозиготная (D/D), так и гетерозиготная (I/D) форма варианта D [14].


Генетический полиморфизм ангиотензинпревращающего фермента у подростков с эссенциальной артериальной гипертензией [Электронный ресурс] / Баирова [и др.] // Российский вестник перинатологии и педиатрии .— 2007 .— №4 .— С. 32-40 .— Режим доступа: https://rucont.ru/efd/517689

Автор: Баирова

Молекулярно-генетический анализ инсерционно-делеционного полиморфизма гена ангиотензинпревращающего фермента (ACE) в популяции русских и бурятов Восточной Сибири выявил тенденцию превалирования делетированного аллеля в группе подростков, страдающих эссенциальной артериальной гипертензией. Показано участие делетированного аллеля гена ACE в реализации таких показателей, как нагрузка давлением, вариабельность систолического артериального давления и периферическое сосудистое сопротивление, у подростков обеих изучаемых этнических групп

Не обнаружено ассоциации полиморфного маркера типа I/D гена АСЕ с артериальной гипертензией и величиной <...> D всего I D абс. % % % абс. % % % Мать 33 34,02 47,05 52,95 17 25,00 28,57 71,43 Отец 31 31,96 46,87 <...> Ассоциация полиморфного маркера типа I/D гена АСЕ с концентрической гипертрофией левого желудочка была <...> Показатели центральной гемодинамики у больных с разными генотипами полиморфного маркера I/D гена АСЕ <...> Полиморфные маркеры I/D и G7831A гена фермента, превращающего ангиотензин I, и гипертрофия миокарда у


РОЛЬ ГЕНОВ РЕНИН-АНГИОТЕНЗИН-АЛЬДОСТЕРОНОВОЙ СИСТЕМЫ В ПАТОГНЕЗЕ ГЕПАТОРЕНАЛЬНОГО СИНДРОМА НА ФОНЕ АЛКОГОЛЬНОГО ЦИРРОЗА ПЕЧЕНИ [Электронный ресурс] / Поликарпова [и др.] // Вопросы наркологии .— 2010 .— №3 .— С. 39-48 .— Режим доступа: https://rucont.ru/efd/477553

Автор: Поликарпова

Основной причиной смерти пациентов с декомпенсированным алкогольным циррозом печени является гепаторенальный синдром (ГРС), представляющий собой функциональную почечную недостаточность. Ренин-ангиотензиновая система включена в патогенез ГРС. Особый интерес представляет изучение гена ангиотензиногена как фактора, который может определять индивидуальные особенности фиброгенеза. Кроме того, ген ангиотензиногена рассматривается как ген-кандидат, определяющий развитие алкогольной зависимости.

При комбинации М-аллеля гена ангиотензиногена Т174М и DD-генотипа гена АПФ I/D повышен риск летального <...> Таким образом, можно предполагать, что при ГРС будут преобладать I-аллели гена АПФ I/D. <...> D пациенты делились на 2 группы (с I-аллелем — II и ID-генотипы и без I-аллеля — DD-генотип). <...> Т174М и I-аллеля гена АПФ I/D и составляет 70% (7 человек из 10). <...> При ТТ-генотипе гена ангиотензиногена Т174М при сочетании его с I-аллелем гена АПФ I/D двухнедельная


АССОЦИАЦИИ ЧЕТЫРЕХ ПОЛИМОРФНЫХ ГЕНЕТИЧЕСКИХ СИСТЕМ (АСЕ, EPAS1, ACTN3 И NOS3) СО СПОРТИВНОЙ УСПЕШНОСТЬЮ В БОРЬБЕ САМБО [Электронный ресурс] / Бондарева [и др.] // Вестник Московского университета. Серия 23. Антропология. .— 2010 .— №1 .— С. 36-45 .— Режим доступа: https://rucont.ru/efd/480504

Автор: Бондарева

Многочисленные молекулярно-генетические исследования дают основания для целенаправленного отбора перспективных спортсменов и правильного выбора спортивной специализации (спринтер или стайер) в циклических видах спорта на основании результатов оценки генетической предрасположенности к конкретному виду двигательной деятельности. Вместе с тем, учитывая существенные фенотипические отличия в условиях и характере соревновательной и тренировочной деятельности спортсменов, специализирующихся в нециклических видах спорта, представляется необходимым дополнительное уточнение и экспериментальная проверка возможности переноса данных, полученных в циклических видах, на другие спортивные дисциплины. В статье представлены результаты генотипирования 227 высококвалифицированных спортсменов Российской Федерации, занимающихся борьбой самбо, по I/D полиморфизму гена ангиотензин I-превращающего фермента ( АСЕ I/D, rs4646994), R577X полиморфизму гена альфа-актинина 3 ( ACTN3 R577X, rs1815739), E298D полиморфизму гена синтазы окиси азота ( eNOS E298D, rs1799983) и A/G полиморфизму гена эндотелиального белка ( EPAS1 A/G, rs1867785). Анализ распределения частот генотипов показал статистически значимые различия между экспериментальной группой борцовсамбистов и контрольной популяцией для генов ACTN3, NOS3 и EPAS1. Статистически значимых различий между сравниваемыми группами не обнаружено по распределению генотипов АСЕ. Таким образом, прямой перенос результатов, по лученных на материале циклических видов спорта, с осторожностью должен быть использован для видов спортивных единоборств. Наблюдаемые генетически обусловленные различия между спортсменами самбистами и контролем по большинству из изученных полиморфных систем, но отсутствие различий между самими спортсменами в процессе роста динамики их специализации, подчеркивает роль изначального отбора индивидов для успешных перспектив в данном виде спорта в зависимости от наследственных особенностей Такой отбор имеет место уже на ранних стадиях специализации спортсменов в отношении борьбы самбо.

D ïîëèìîðôèçìó ãåíà àíãèîòåíçèí I-ïðåâðàùàþùåãî ôåðìåíòà (ÀÑÅ I/D, rs4646994), R577X ïîëèìîðôèçìó ãåíà <...> Â ðåçóëüòàòå èññëåäîâàíèÿ áûëè ãåíîòèïèðîâàíû 227 áîðöîâ-ñàìáèñòîâ ïî I/D ïîëèìîðôèçìó ãåíà ÀÑÅ. <...> Ãåíîòèïèðîâàíèå îáðàçöîâ ïî ïîëèìîðôèçìó ÀÑÅ I/D rs4646994 ïðîâîäèëè ìåòîäîì ïîëèìåðàçíîé öåïíîé ðåàêöèè <...> Nazarov I.B., Woods D.R., Montgomery H.E., Shneider O.V., Kazakov V.I., Tomilin N.V., and Rogozkin V.A <...> The angiotensin-converting enzyme I/D polymorphism in Russian athletes // Eur. J. Hum. Genet. 2001.


I/D ‒ ПОЛИМОРФИЗМ ГЕНА АСЕ АССОЦИИРОВАН С ФУНКЦИОНАЛЬНЫМ СОСТОЯНИЕМ СОТРУДНИКОВ ЦЕНТРА СПЕЦИАЛЬНОГО НАЗНАЧЕНИЯ ВНЕВЕДОМСТВЕННОЙ ОХРАНЫ МВД РОССИИ [Электронный ресурс] / О.В. Неголюк [и др.] // Экстремальная деятельность человека .— 2015 .— №3(36) .— С. 38-41 .— Режим доступа: https://rucont.ru/efd/464408

Автор: Неголюк Олег Васильевич

Проведено исследование ассоциаций инсерционно-делеционного полиморфизма гена АСЕ с показателями физической работоспособности у сотрудников Центра специального назначения вневедомственной охраны МВД России. Частоты встречаемости генотипов в контрольной и экспериментальной группах составили: ACE*II 30,4%, ACE*ID 44,6%, ACE*DD 25,0% и ACE*II 11,1%, ACE*ID 61,1%, ACE*DD 27,8% соответственно (χ2 = 2,97 р=,22). Выявлены ассоциации I/D-полиморфизма гена АСЕ с показателями физической подготовленности. Наилучшие результаты в беге на 1 км продемонстрировали сотрудники, в генотипе которых присутствуют два инсерционных аллеля гена АСЕ. В среднем они преодолели дистанцию в 1 км за 3 минуты и 19 секунд (р=,006). Носители двух делеционных аллелей показали наихудшие результаты – около 4 минут. Таким образом, наличие в геноме испытуемых двух инсерционных аллелей гена АСЕ является маркером повышенных аэробных возможностей

Выявлены ассоциации I/D-полиморфизма гена АСЕ с показателями физической подготовленности. <...> – превращающего фермента (I/D ACE) [2]. <...> Исследование I/D полиморфизма у российских спортсменов показа‑ ло увеличение частоты встречаемости D‑аллеля <...> Nazarov I. B., Woods D. R., Montgomery H. E., Shneider O.V., Kazakov V. I., Tomilin N. <...> Th e angiotensin‑converting enzyme I/D polymorphism in Russian athletes.


Ассоциация полиморфизмов генов АСЕ, СМА1 и BDKRB2 с состоянием кислородтранспортной системы организма у юношей с разным уровнем двигательной активности [Электронный ресурс] / Даутова, Шамратова, Воробьева // Журнал медико-биологических исследований .— 2019 .— № 3 .— С. 251-260 .— Режим доступа: https://rucont.ru/efd/702532

Автор: Даутова

Рассмотрена ассоциация полиморфных вариантов rs4646994 (I/D) гена АСЕ, rs1800875 (-1903A>G) гена CMA1 и rs5810761 (+9/-9) гена BDKRB2 с рядом параметров кислородтранспортной системы организма юношей с разным уровнем двигательной активности. Оценивались следующие показатели кислород- транспортной системы: системы крови – число эритроцитов, уровень гемоглобина, гематокрит, средний объем эритроцита, среднее содержание и средняя концентрация гемоглобина в клетке; гемодинамики – артериальное давление, частота сердечных сокращений, удельный минутный объем кровообращения; интегральные показатели деятельности сердечно-сосудистой системы – индекс напряжения миокарда, уровень физического состояния, коэффициент выносливости и коэффициент экономизации кровообращения. Степень доступности кислорода для тканей определялась по показателю р50 (напряжение O2 при 50 %-й десатурации крови). Показано, что физически малоактивным юношам с аллелью *I гена АСЕ свойственны более экономное функционирование сердечно-сосудистой системы, а также более эффективная регуляция сродства гемоглобина к кислороду. При наличии в генотипе аллеля *+9 гена BDKRB2 лица, испытывающие гиподинамию, характеризуются гиперкинетическим типом кровообращения и низкой толерантностью к физическим нагрузкам. В группе спортсменов протективную роль несет в себе аллель *G гена CMA1, обе- спечивая улучшение резервных и компенсаторных возможностей сердечно-сосудистой системы. На основании совместного корреляционного анализа трех полиморфных вариантов генов АСЕ, CMA1 и BDKRB2 сделан вывод о влиянии аллелей *I, *G и *-9 на состояние красной крови у спортсменов: увеличение числа данных аллелей в генотипе сопряжено с уменьшением количественных (число эритроцитов) и повышением качественных показателей крови (средний объем эритроцита и содержание гемоглобина в клетке).

Полиморфный вариант I/D (АСЕ) связан с делецией (D) или инсерцией (I) Aluповтора размером 287 п. н. в <...> Действительно, в ряду D/DI/DI/I уменьшаются ЧСС (77,8±1,7; 76,3±1,6 и 73,2±2,6 уд. <...> D и I/I как в группе юношей с НДА, так и в группе спортсменов (рис. 2). <...> размеры (82,2± ±1,0 фл) по сравнению с обладателями генотипов I/I (88,6±0,3 фл; р < 0,05) и I/D (85,8 <...> Akhmetov I.I., Popov D.V., Astratenkova I.V., Druzhevskaya A.M., Missina S.S., Vinogradova O.L., Rogozkin


Клиническая картина гипертрофической кардиомиопатии и генетический полиморфизм аденозинпревращающего фермента [Электронный ресурс] / Комиссарова [и др.] // Кардиология в Беларуси .— 2011 .— №3 .— С. 83-91 .— Режим доступа: https://rucont.ru/efd/491688

Автор: Комиссарова

Изучена ассоциация клинической картины, структурных и функциональных особенностей миокарда левого желудочка с I/D полиморфизмом гена ACE у больных с гипертрофической кардиомиопатией (ГКМП). Выявлено, что тяжесть клинических проявлений ГКМП более выражена у генотипов ID и DD. Генотип DD в большей степени влияет на изменение диастолической функции левого желудочка и ассоциируется с удлинением дисперсии корригированного интервала QT

Показано, что полиморфизм I/D гена АСЕ влияет на клинические параметры, однако результаты исследований <...> Отмечена связь I/D-полиморфизма с уровнем АПФ в плазме и некоторых тканях, прежде всего в миокарде [15 <...> I/D полиморфизм в гене AСЕ изучали с использованием метода полимеразной цепной реакции (ПЦР). <...> При необструктивной форме заболевания значимые нарушения ритма, Рисунок 2 Распределение генотипов I/D-полиморфизма <...> Patel, R., Lim, D.S., Reddy, D. et al.


Метаболический синдром у детей и подростков. Клинико-генетические параллели [Электронный ресурс] / Синицын [и др.] // Артериальная гипертензия .— 2010 .— №5 .— С. 49-53 .— Режим доступа: https://rucont.ru/efd/347712

Автор: Синицын

Цель исследования — разработать, на основании анализа результатов клинико-генетического обследования детей с ожирением, принцип формирования групп риска развития метаболического синдрома (МС) для осуществления ранней профилактики синдрома и его осложнений. Материалы и методы. Обследованы 194 ребенка в возрасте 13,19 ± 0,14 года: 148 человек с ожирением I–IV степени и 46 человек с нормальной массой тела, сопоставимые по возрасту и полу. Оценивали анамнез, антропометрические данные, уровень артериального давления (АД), липидный спектр, в том числе общий холестерин (ОХС), триглицериды (ТГ), холестерин липопротеидов высокой плотности (ХС ЛПВП), холестерин липопротеидов низкой плотности (ХС ЛПНП), обмен углеводов и мочевой кислоты. 83 ребенка с ожирением были генотипированы на полиморфизмы: I/D гена ACE, G-75A ApoA1, S19W ApoA5, S1/ S2 ApoC3, E2/E3/E4 ApoЕ и W/R ADRB3. Результаты. Более 2/3 обследованных детей с ожирением имели отягощенную наследственность по ведущим факторам риска развития сердечно-сосудистой патологии. Артериальная гипертензия выявлена у 35,8 % детей; дислипидемия — у 77,8 %. У 29,0 % детей диагностирована гипергликемия и у 25,0 % — гиперурикемия. 57,0 % носителей D-аллеля гена ACE имели превышающее норму АД. Более 50,0 % носителей «неблагоприятных» аллелей апопротеиновых генов имели дислипидемию. У 60,3 % гомозигот W/W гена ADRB3 выявлены нарушения липидного и углеводного обмена. Выводы. На основании выявленных у детей с ожирением устойчивых сочетаний конституциональных, метаболических и молекулярно-генетических факторов разработан метод обследования с оригинальными принципами формирования групп риска развития МС и тактикой дальнейшего ведения пациента.

D гена ACE, G-75A ApoA1, S19W ApoA5, S1/ S2 ApoC3, E2/E3/E4 ApoЕ и W/R ADRB3. <...> Shcherbakova1, V.I. <...> D gene ACE, G-75A ApoA1, S19W ApoA5, S1/S2 ApoC3, E2/ E3/E4 ApoЕ and W/R ADRB3. <...> При генотипировании на I/D полиморфизм гена ACE, отвечающего за активность синтеза ангиотензинпревращающего <...> D и параллельное снижение генотипа I/I (p < 0,05) по мере увеличения степени ожирения.


Фармакогенетика в онкологии и кардиологии: новый взгляд на роль полиморфизмов генов ренин-ангиотензин-альдостероновой системы [Электронный ресурс] / Конончук [и др.] // Рецепт .— 2013 .— №6 .— С. 131-140 .— Режим доступа: https://rucont.ru/efd/499802

Автор: Конончук

Сердечно-сосудистые и онкологические заболевания являются двумя основными причинами заболеваемости и смертности во всем мире. Хорошо известна роль ренин-ангиотензин-альдостероновой системы в патогенезе большинства сердечно-сосудистых заболеваний, кардиоваскулярных осложнений комплексного лечения рака молочной железы (РМЖ), а также в процессах канцерогенеза. Этот обзор указывает на участие полиморфизма генов АПФ, АТR1, АТГ в развитии и прогрессировании сердечно-сосудистых заболеваний и РМЖ, а также на влияние генетических факторов на лекарственную терапию при лечении кардиоваскулярной патологии

Полиморфизм I/D гена АПФ Ген АПФ имеет инсерционно-делеционный полиморфизм (I/D), обусловленный вставкой <...> (инсекцией – I) или выпадением (делецией – D) фрагмента из 287 нуклеотидов в 16-м интроне гена АПФ [ <...> Метаанализ 58 исследований показал значимое влияние полиморфизма I/D гена АПФ на развитие коронарных <...> Ряд исследований установил влияние полиморфизма I/D гена АПФ на риск развития РМЖ [34]. <...> Полиморфизм I/D гена АПФ моделирует ответ на терапию и-АПФ.


№1 [Молекулярная генетика, микробиология и вирусология, 2013]

Основан в 1983 г. Главный редактор журнала - Костров Сергей Викторович - член-корреспондент РАН, профессор, доктор биологических наук, директор Института молекулярной генетики РАН. Журнал освещает наиболее актуальные теоретические и прикладные проблемы молекулярной генетики про- и эукариотных организмов, молекулярной микробиологии и молекулярной вирусологии. Важную роль журнал отводит исследованиям генетического аппарата микроорганизмов, изысканиям форм генетического обмена, генетического картирования патогенных возбудителей, выяснению строения и функций внехромосомных факторов наследственности и мигрирующих генетических элементов, теоретическим исследованиям механизмов генетической регуляции. Публикует результаты исследований молекулярных и генетических основ эукариотной клетки, функционирования хромосом и хроматина, природы генетических изменений при злокачественном перерождении и ряде наследственных заболеваний. На страницах журнала освещается разработка молекулярных основ вирусологии, в том числе вопросы интеграции вирусных и клеточных геномов, вопросы персистенции.

I 244 22,2 109 23,8 0,11 56 25,9 18 18,0 0,08 I/D 552 50,2 246 53,7 82 38,0 51 51,0 D/D 304 27,6 103 <...> 22,5 78 36,1 31 31,0 I/I+I/D 796 72,4 355 77,5 0,04 0,8 [0,59; 0,98] 138 63,9 69 69,0 0,45 0,8 [0,48; <...> частоты генотипов I/I и I/D по сравнению с контрольной группой. <...> на 31%, а у лиц с генотипом D/D – на 58% по сравнению с носителями генотипа I/I [30]. <...> I 197 21,8 109 23,8 0,06 44 24,1 18 18,0 0,16 I/D 449 49,7 246 53,7 72 39,3 51 51,0 D/D 257 28,5 103

Предпросмотр: Молекулярная генетика, микробиология и вирусология №1 2013.pdf (1,4 Мб)

Молекулярно-генетические особенности у больных артериальной гипертензией, перенесших инсульт [Электронный ресурс] / Карпенко [и др.] // Артериальная гипертензия .— 2007 .— №1 .— С. 51-57 .— Режим доступа: https://rucont.ru/efd/347874

Автор: Карпенко

Целью данной работы стало изучение ассоциации между полиморфизмом генов ангиотензинпревращающего фермента (ACE), рецептора ангиотензина II 1 типа (ATR1), аполипопротеина СIII (APO CIII), апопротеина Е (APO E), фермента метилентетрагидрофолатредуктазы (MTHFR), фибриногена (Fb), эндотелиальной NO-синтетазы (NOS3) и развитием инсульта у больных АГ (n=41), а также изучение, влияния полиморфизма вышеуказанных генов на параметры, характеризующие синдром АГ. Проведенное исследование показало, что развитие ОНМК у больных АГ ассоциировано с А1166С полиморфизмом гена ATR1, G-455A полиморфизмом гена Fb и С677Т полиморфизмом гена MTHFR. При этом маркерами повышенного риска выступают С-аллель гена ATR1 и АА-генотип гена Fb, а протективную роль в отношении развития ОНМК у больных АГ играют А-аллель и АА-генотип гена ATR1, СС-генотип гена MTHFR. Также установлено, что у больных, имеющих ID- и DD-генотипы гена ACE, АС- и СС-генотипы гена ATR1, ТТ- и СТ-генотипы гена MTHFR, АА-генотип гена Fb, достоверно наибольшие значения имеют параметры структурно-функционального состояния ССС и МС, определяющие степень риска развития инсульта у больных АГ.

Also figured out that patients with I/D and DD6genotype of ACE6gene, AC and CC genotypes of ATR1 gene <...> Целью нашего исследования явилось изучение ассо6 циации I/D полиморфизма гена ангиотензинпревраща6 ющего <...> Те6 стирование на I/D полиморфизм гена ACE и А1166С полиморфизм гена ATR1 проведено в обеих группах. <...> D полиморфизма гена ACE было вы6 явлено, что для больных АГ с I/D6 и DD6генотипами гена ACE наибольшие <...> Также обращает вни6 мание, что у больных с I/D6 и DD6генотипами АГ мани6 Рис. 1.


Структурные особенности ДНК у женщин с ишемической болезнью сердца [Электронный ресурс] / Анисенкова [и др.] // Артериальная гипертензия .— 2008 .— №1 .— С. 51-56 .— Режим доступа: https://rucont.ru/efd/347831

Автор: Анисенкова

Изучены особенности течения ишемической болезни сердца, факторы риска, результаты коронарной ангиографии, особенности структуры кандидатных генов (I/D полиморфизм гена ACE, изоаллельный полиморфизм гена APOE, SstI полиморфизм гена APOC3, 5,10–C677T полиморфизм гена MTHFR и 4a/4b, G894T, T786C полиморфизмы гена eNOs) у 89 женщин с различной степенью поражения коронарного русла. Проведенное исследование показало, что у пациенток с ИБС, имеющих стенозирующий атеросклероз, в большинстве случаев отмечается наследственная отягощенность по этому заболеванию со стороны одного или двух родителей (в большей степени по материнской линии). В развитии ИБС у этих пациенток достоверную роль играет носительство аллеля Т, генотипа СТ гена MTHFR и ген — генных взаимодействий ACE и MTHFR (DD и CC, DD и CT).

Kuchinskii, V.I. Larionova, M.A. Bogdanova, V.K. Suchov, I.N. Kochanov St. <...> У этой группы детей была изучена распространённость I/D полиморфизма гена ACE и полиморфных аллелей гена <...> Таблица 2 изуЧенные генетиЧесКие полиморфизмы гены сокращенное название полиморфизмы АпФ ACE I/D Аполипопротеин <...> ,Wilcken D.E. <...> Singh S.P., Eddy J.D.


№10 [Российский кардиологический журнал, 2014]

Официальный орган печати Российского кардиологического общества (РКО), научно-практический рецензируемый журнал. Главный редактор — Шляхто Е.В., Президент РКО, академик РАН, профессор, директор ФГБУ Федеральный Центр сердца, крови и эндокринологии им. В.А. Алмазова. Это научно-практический, рецензируемый журнал для кардиологов и терапевтов. Основная направленность издания — научные статьи, посвященные оригинальным и экспериментальным исследованиям, вопросам фармакотерапии и кардиохирургии сердечно-сосудистых заболеваний, новым методам диагностики. Российский кардиологический журнал выпускается с 1996г., включен в перечень изданий, рекомендованных для публикации статей, содержащих материалы диссертаций (ВАК), в индексы цитирования: Российский индекс научного цитирования, Scopus; зарегистрирован в Клубе главных редакторов научных журналов Европейского общества кардиологов.

S., Ivanoschuk D. E., Savchenko S. V., Voevoda M. I. <...> Cugino D, Gianfagna F, Santimone I, et al. <...> D. 1 , Voevoda M. I. 2, 3 Aim. <...> Известен I/D полиморфизм (rs4340) гена АСЕ, связанный с инсерцией (I) или делецией (D) Alu повтора размером <...> 51,87 53,85 50,0 49,6 Аллель D 48,13 46,15 50,0 50,4 p1 0,038 0,910 p2 0,858 0,949 ОР D/I 1,081 (ДИ:

Предпросмотр: Российский кардиологический журнал №10 2014.pdf (0,5 Мб)

Молекулярно-генетический анализ и прогнозирование риска развития преэклампсии у беременных с сахарным диабетом типа 1 [Электронный ресурс] / Грибанов, Горовенко, Россоха // Репродуктивное здоровье. Восточная Европа .— 2015 .— №5 .— С. 79-88 .— Режим доступа: https://rucont.ru/efd/476108

Автор: Грибанов

Поиск прогностических маркеров преэклампсии у беременных с сахарным диабетом 1-го типа  (СД  1) является актуальной клинической задачей, решение которой невозможно без использования современных методов молекулярной медицины. Полиморфизм генов ренин-ангиотензиновой системы (РАС) вовлечен в формирование сосудистых осложнений как при СД 1, так и при преэклампсии без предшествующего диабета, что делает закономерной необходимость изучения их влияния на риск преэклампсии у беременных с этим заболеванием. По результатам ретроспективного анализа историй болезни в основную группу было включено 30 женщин с СД 1 и клиническими проявлениями преэклампсии во время беременности, а в группу сравнения – 30 женщин с заболеванием без преэклампсии. У всех женщин были детально проанализированы более 50 клинико-лабораторных маркеров в I триместре беременности и результаты молекулярно-генетического исследования 5 полиморфных вариантов 4 генов. Наличие диабетической нефропатии в сочетании с увеличением ИМТ, ID и DD генотипами по гену АСЕ были прогностическими маркерами риска развития преэклампсии. Выявлена ассоциация ID и DD генотипов по гену АСЕ с риском развития преэклампсии у беременных с СД 1, а наилучшей статистической моделью межгенного взаимодействия в риске развития преэклампсии у беременных была трехлокусная: ACE (ID)/PON1 (С108Т)/eNOS (G894T). Беременным с СД 1 и нефропатией при наличии генотипов ID и DD по гену АСЕ необходимо проводить тщательный контроль ренальной функции и профилактику преэклампсии с ранних сроков беременности.

Значимое влияние на возрастание риска развития преэклампсии имел ген ACE (I/D), наличие генотипа ID у <...> D) 10/10 70,00 2 PON1 (C108T)/eNOS (G894T) 7/10 58,33 3* ACE (I/D)/PON1 (C108T)/eNOS (G894T) 10/10 76,67 <...> D) + PON1 (С108Т) АСЕ(II)/PON1 (108CC) 1 3,33 13 43,33 11,27 0,05 0,001 0,01–0,38 ACE (I/D) + eN0S (4b <...> /4a) АСЕ(II)/eNOS (4b/4a) 0 0,00 7 23,33 5,82 – 0,016 – ACE (I/D) + eN0S (G894T) ACE(ID)/eNOS(894GG) <...> Alkanli N., Sipahi T., Kilic T.O., Sener S. (2014) Lack of association between ACE I/D and AGTR1 A1166C


ГЕН АПОЛИПОПРОТЕИНА А1 И ЕГО РОЛЬ В РАЗВИТИИ ДИСЛИПИДЕМИИ У ПАЦИЕНТОВ РАЗНЫХ ЭТНИЧЕСКИХ ГРУПП С ЭССЕНЦИАЛЬНОЙ АРТЕРИАЛЬНОЙ ГИПЕРТЕНЗИЕЙ [Электронный ресурс] / Баирова [и др.] // Российский кардиологический журнал .— 2012 .— №6 .— С. 19-23 .— Режим доступа: https://rucont.ru/efd/458878

Автор: Баирова

Оценить вклад инсерционно-делеционного полиморфизма гена аполипопротеина А1 в реализацию дислипидемии у подростков с эссенциальной артериальной гипертензией (ЭАГ) разных этнических групп: некоренной славянской и коренной бурятской

Вместе с тем, данные о роли инсерционно-делеционного полиморфизма (I/D) гена АроА1 в развитие дислипидемии <...> аллелей Гетегозиготность χ 2 р I D Наблюдаемая Ожидаемая 1 Русские здоровые, RZ (n = 94) II ID DD 79 <...> Результаты Проведено исследование распространенности инсерционно-делеционного полиморфизма (I/D) гена <...> Частоты генотипов полиморфного маркера I/D гена АроА1 у здоровых подростков разных этнических групп были <...> I., Munkoeva D. M. Aim.


Ограничения математической точности и новые генотип-специфические платформы [Электронный ресурс] / Нагай, Срожидинова, Хамидуллаева // Инновационные технологии в медицине .— 2015 .— №2-3 .— С. 89-97 .— Режим доступа: https://rucont.ru/efd/482790

Автор: Нагай

Диагностическая производительность теста, или способность теста различать больные случаи из обычных, оценивается с помощью принятия операционных характеристик или анализа ROC Ограничения математической точности в качестве меры принятия решения требуют введения понятий «чувствительность» и «специфичность» для диагностического теста. Эти меры и связанные с ними показатели, «истинно-положительная фракция» и «ложно положительная фракция» являются более значимыми, чем «точность», но не обеспечивают индивидуальное описание диагностической производительности, так как они зависят от произвольного выбора порога принятия решения.

В нашем исследовании проанализированы на прогностическую значимость 4 блока генов: 1-й блок – ACE (I/ <...> : OR = (a / b) / (c / d) = (a × d) / (b × c), (7) 95% CI = exp (In (RR) – 1,96 × SE {In (RR)}) to exp <...> Полученные данные указывают, что генотипы 6 генов – ACE D/D, CYP11B2 Т/Т, β2-AR Glu27Glu, B2BKR 9+/+9 <...> LR+ LR– PV+ PV– RR P – II 22 (0,18) 34 (0,57) –5 18,49 43,33 0,33 1,88 39,29 21,14 0,32 <0,0001 ACE I/ <...> Vzaimosvyaz› mezhdu I/D polimorfi zmom gena angiotenzinirevrashhayushhego fermenta i vozmozhnost›yu razvitiya


Влияние эналаприла на функцию почек с учетом полиморфизма гена ангиотензин-превращающего фермента при гипертензивной нефропатии [Электронный ресурс] / Жолдошов [и др.] // Кардиоваскулярная терапия и профилактика .— 2010 .— №5 .— С. 53-58 .— Режим доступа: https://rucont.ru/efd/463069

Автор: Жолдошов

Изучить влияние эналаприла на суточную протеинурию, почечную функцию, выживаемость больных эссенциальной артериальной гипертонией (ЭАГ) и показатели внутрипочечной гемодинамики в зависимости от I/D полиморфизма гена ангиотензин-превращающего фермента (АПФ)

Как известно, от типа полиморфизма (insertion/deletion I/D) в интроне 16 гена АПФ в определенной мере <...> D полиморфизма гена АПФ. <...> Анализ I/D-полиморфизма гена АПФ проводили методом полимеразной цепной реакции (ПЦР) с употреблением <...> Результаты и обсуждение Для изучения ассоциации I/D полиморфизма гена АПФ с изменением почечной функции <...> Influence of the I/D 12.


Риск микрососудистых осложнений сахарного диабета 2-го типа при различных генотипах гена ангиотензинпревращающего фермента [Электронный ресурс] / Чак // Кардиология в Беларуси .— 2017 .— №2 .— С. 72-72 .— Режим доступа: https://rucont.ru/efd/609339

Автор: Чак

Введение. Несмотря на достаточно большое количество работ о связи гена ангиотензинпревращающего фермента (АСЕ) с развитием сахарного диабета 2-го типа (СД 2), единого мнения по этому вопросу нет. Лишь единичные исследования посвящены взаимосвязи гена АСЕ и микрососудистых осложнений при СД 2

Исследование взаимосвязи I/D (вставка/выпадение) полиморфизма гена АСЕ и риска развития микрососудистых <...> Таким образом, на риск развития микроангиопатий влияют длительность СД 2-го типа, ИМТ и I/D полиморфизм


Полиморфизм генов ренин-ангиотензиновой системы и дисфункция эндотелия у мужчин, перенесших инфаркт миокарда в молодом возрасте [Электронный ресурс] / Беркович [и др.] // Артериальная гипертензия .— 2008 .— №3 .— С. 57-62 .— Режим доступа: https://rucont.ru/efd/347844

Автор: Беркович

В работе оценивалась связь полиморфизмов генов РААС с параметрами, характеризующими функциональное состояние эндотелия у мужчин, перенесших инфаркт миокарда в молодом возрасте. Установлено наличие дисфункции эндотелия у мужчин, перенесших инфаркт миокарда в молодом возрасте. Установлено, что носительство определенных генотипов генов РААС не ассоциируется с увеличением риска инфаркта миокарда. Вместе с тем, носительство D аллеля гена АПФ и GG генотипа гена ангиотензиногена, ассоциируется с более выраженным нарушением функционального состояния эндотелия у мужчин, перенесших инфаркт миокарда в молодом возрасте. Это подтверждает предположение о возможном влиянии полиморфизмов генов РААС на функциональное состояние эндотелия сосудов.

Для анализа I/D полиморфизма гена ангиотензинпревращающего фермента (АпФ) использовали метод B.C. <...> I/D полиморфизм гена АПФ был определен у 200 больных ИБС и у 143 здоровых мужчин. <...> Мужчин группы численность генотип гена аПф встречаемость аллеля II ID DD I D больные иБС n 200 48 115 <...> ACE I/D gene polymorphism: presence of the D allele increases the risk of coronary artery disease in <...> Henrion D., Benessiano J., Philip I., Vuillaumier-Barrot S., Iglarz M., Plantefeve G., Chatel D., hvass


№1 [Атеросклероз, 2009]

В журнале публикуются работы в области фундаментальных и клинических проблем атеросклероза и заболеваний атеросклеротического генеза по следующим разделам: факторы риска этиопатогенез, диагностика, профилактика и лечение; краткие обобщенные данные последних российских и международных конгрессов по атеросклерозу, другая интересная для врачей и ученых информация. На сегодняшний день крайне высока смертность от заболеваний атеросклеротического генеза не только в России, но и во всех индустриально развитых странах. Благодаря достижениям мировой и российской науки накоплено огромное количество данных по многим вопросам атеросклероза. Возросла необходимость быстрого и объективного информирования врачей и научных работников о современных взглядах на проблему атеросклероза, вовлечение их в обсуждение результатов новых научных исследований и рекомендаций. Учредитель журнала: Учреждение Российской академии медицинских наук Научно-исследовательский институт терапии СО РАМН.

I I/D D/D 0,234(0,044) n = 22 0,532(0,051) n = 50 0,234(0,044) n = 22 0,238(0,032) n = 43 0,536(0,037 <...> I – аллель с инсерцией Alu-элемента, D – аллель без Alu-элемента, I/I, I/D, D/D – соответствующие генотипы <...> I/D на 11,7 %, а генотипа D/D возросла на 35,5 %. <...> генотип I/D. <...> I, I/D И D/D соответственно (Wang X.L., 1996).

Предпросмотр: Атеросклероз №1 2009.pdf (0,1 Мб)

Делеции генов детоксикации ксенобиотиков и синтез иммуноглобулина Е при аллергических заболеваниях у детей. [Электронный ресурс] / Долгополов [и др.] // Клиническая лабораторная диагностика .— 2016 .— №9 .— С. 64-64 .— Режим доступа: https://rucont.ru/efd/487041

Автор: Долгополов

Широкое распространение, тенденция к утяжелению течения и высокая затратность аллергических заболеваний у детей определяют их в группу социально-значимых проблем и актуальность изучения факторов предрасполагающих к инициации и реализации болезни.

измерение площади моноклонального пика при электрофорезе) для установления стадии симптоматической миеломы (I, <...> мониторинг содержания общего иммуноглобулина E (IgE) в сыворотке крови и детекция полиморфных маркеров I/ <...> D генов детоксикации ксенобиотиков GSTM1 и GSTT1. <...> Детекцию полиморфных маркеров I/D генов GSTM1 и GSTT1 выполняли с применением наборов ГосНИИгенетики


№4 [Вестник Адыгейского государственного университета. Серия: Естественно-математические и технические науки, 2012]

публикуются результаты исследований по биологическим, физико-математическим и техническим наукам. В разделе «Математика и компьютерные науки» публикуются результаты, полученные в области теоретической, прикладной математики, компьютерных наук. В разделе «Физика и технические науки» публикуются результаты исследований по физическим и техническим наукам, в том числе по общим вопросам физики, общим проблемам физического эксперимента, физике элементарных частиц, теории полей и др. В разделе «Естественные науки» публикуются результаты фундаментально-ориентированных исследований в области рационального природопользования и охраны природных ресурсов, многолетних исследований по физиологии развития человека, биоразнообразию Северного Кавказа, рассматриваются вопросы создания концептуальной модели онтогенеза и адаптации в условиях полимодальных воздействий среды, создания и реализации здравоцентристской парадигмы здоровья учащейся молодежи, экологические основы рационального освоения природных ресурсов. В разделе «Геоинформационные системы» публикуются данные, составляющие интеллектуальную географическую информационную систему, основанные на знаниях и обеспечивающие комплексную диагностику эколого-ресурсного потенциала территории, рассматриваются вопросы технологии автоматизированной географической диагностики территории и др

: 0,70 I: 0,210 D: 0,790 5. <...> : 0,340 I: 0,340 D: 0,660 7. <...> 0,090 0,454 D 0,910 0,546 0,007* 7,33 I I 9,0% 18,2% I/D 0% 54,5% Адыги (n=11/11) DD 91,0% 27,3% 0,006 <...> ** 10,10 I 0,113 0,310 D 0,887 0,690 0,03* 4,98 I I 4,5% 14,3% I/D 13,6% 33,3% Русские (n=22/21) DD 81,9% <...> Farber D.A., Anisimova I.O.

Предпросмотр: Вестник Адыгейского государственного университета. Серия Естественно-математические и технические науки №4 2012.pdf (0,1 Мб)

Сосудистые когнитивные нарушения: возможные механизмы развития [Электронный ресурс] / Зуева // Артериальная гипертензия .— 2013 .— №4 .— С. 47-54 .— Режим доступа: https://rucont.ru/efd/353931

Автор: Зуева

Распространенность сосудистых когнитивных нарушений возрастает по мере старения населения. Учитывая растущее медицинское, социальное и экономическое значение сосудистых когнитивных нарушений, их профилактика и лечение являются важными приоритетами в настоящее время. Выявление механизмов развития сосудистых когнитивных нарушений позволит целенаправленно проводить первичную и вторичную профилактику, а также осуществлять своевременную терапию.

В настоящее время нет единого мнения, есть ли ассоциация между I/D полиморфизмом гена АПФ и ангиотензиногена <...> I. <...> Chui H.C., Victoroff J.I., Margolin D., Jagust W., Shankle R., Katzman R. <...> Association of ACE I/D gene polymorphism with vascular dementia: a meta-analysis // J. Geriatr. <...> No association of angiotensin I converting enzyme I/D polymorphism with domain-specific cognitive function


Особенности иммунологической диагностики аутоиммунных заболеваний печени. [Электронный ресурс] / Дорофеев [и др.] // Клиническая лабораторная диагностика .— 2016 .— №9 .— С. 64-65 .— Режим доступа: https://rucont.ru/efd/487042

Автор: Дорофеев

Среди хронических заболеваний печени неясной этиологии встречается патология, приводящая к быстрому фиброзированию органа и циррозу, выделяют аутоиммунный гепатит (АИГ) и первичный билиарный цирроз печени (ПБЦ). Диагностика АИГ и ПБЦ на бессимптомной стадии значительно повышает эффективность раннего лечения, прогноз заболевания и качество жизни больных во всех возрастных группах

измерение площади моноклонального пика при электрофорезе) для установления стадии симптоматической миеломы (I, <...> мониторинг содержания общего иммуноглобулина E (IgE) в сыворотке крови и детекция полиморфных маркеров I/ <...> D генов детоксикации ксенобиотиков GSTM1 и GSTT1. <...> Детекцию полиморфных маркеров I/D генов GSTM1 и GSTT1 выполняли с применением наборов ГосНИИгенетики <...> (МВ) по массе до операции, через 2, 12 и 48 часов на анализаторе «ARCHITECT i2000» («Abbott», США) с


№4 [Артериальная гипертензия, 2009]

Научно-практический рецензируемый журнал, выходящий в печать с января 1995 года и являющийся официальным периодическим изданием Секции артериальной гипертензии Всероссийского научного общества кардиологов и ООО «Антигипертензивная ЛИГА». В журнале «Артериальная гипертензия» публикуются статьи, посвященные широкому спектру современных проблем артериальной гипертензии - от фундаментальных исследований патологических процессов до результатов клинических испытаний новых лекарственных средств и рекомендаций для кардиологов. В журнале публикуются передовые статьи по вопросам современной диагностики, лечения и профилактики артериальной гипертензии, а также результаты отечественных и зарубежных научных исследований в области кардиологии. ИЗДАТЕЛЬ ВЫКЛАДЫВАЕТ НОМЕРА С ЗАДЕРЖКОЙ В 6 МЕСЯЦЕВ!

., d� Z��uw D. R�NAAL Stud� I���st�g�t��s. <...> D�e� the re�i�-a�gi�te��i�-ald��ter��e �y�tem m�dify cardiac �tructure a�d fu�cti�� i� e��e�tial hyperte <...> (PE) a�d demo�strated that i� PE, immu�o�eutralizatio� of �TS by �i�ibi�d, �ab fra�me�ts of di�o�i� <...> D гена асе Дети и подростки с АГ I/I/II I/D/DD D/D/DD ММ 3 (4 ��)* ��)*��)* 8 (10 ��) ��)��) 5 (6 ��) <...> D гена асе Дети и подростки с АГ I/I I/D D/D АА 8 (12 ��) ��)��) 18 (28 ��) ��)��) 5 (8 ��) ��)��) АС

Предпросмотр: Артериальная гипертензия №4 2009.pdf (0,8 Мб)

ФАРМАКОТЕРАПИЯ ПРИ ИНФАРКТЕ МИОКАРДА: ВКЛАД ГЕНЕТИЧЕСКИХ ФАКТОРОВ [Электронный ресурс] / Солодун // Российский кардиологический журнал .— 2016 .— №3 .— С. 87-92 .— Режим доступа: https://rucont.ru/efd/356357

Автор: Солодун

В настоящее время инфаркт миокарда является значимой медико-социальной проблемой. Смертность в течение года после перенесенного инфаркта миокарда продолжает оставаться высокой, несмотря на терапию всеми, рекомендованными для улучшения прогноза, препаратами. В качестве одной из возможных причин неблагоприятного прогноза может рассматриваться лекарственная устойчивость, связанная с полиморфизмом генов, ответственных за фармакокинетику и фармакодинамику лекарственных средств. В данном обзоре обобщены некоторые, имеющиеся на данный момент, литературные сведения о влиянии полиморфизма генов SLCO1B1, LIPC, CYP2C19, АСЕ, ADRB1 на эффективность фармакотерапии при инфаркте миокарда, что может быть полезным, как для дальнейших научных исследований, так и для улучшения качества долгосрочного лечения данного заболевания путем персонализации медикаментозной терапии.

D). <...> Он обусловлен вставкой (Insertion, I) или отсутствием (Deletion, D) в 16 интроне фрагмента, состоящего <...> К настоящему времени накоплено много знаний о влиянии аллеля D и генотипа DD полиморфного маркера I/D <...> D. <...> Antihypertensive treatment modulates the association between the d/I ACE gene polymorphism and left ventricular


Генетические аспекты риска развития инсультов у детей [Электронный ресурс] / Смульская, Горовенко, Кирьяченко // Экстренная медицина .— 2015 .— №1 .— С. 8-23 .— Режим доступа: https://rucont.ru/efd/474049

Автор: Смульская

В работе представлены данные молекулярно-генетического тестирования 78 детей (основная группа), перенесших острое нарушение мозгового кровообращения по ишемическому (47 детей) и геморрагическому (31 ребенок) типам в возрасте от 0 до 15 лет, и 44 детей контрольной группы. Дети исследуемых групп находились на стационарном или амбулаторном обследовании и лечении в городской детской клинической больнице № 1 г. Киева в период с 01.01.2009 по 01.11.2013. Детям проводилось молекулярно-генетическое исследование генов MTHFR (C677T), MTHFR (A1298C), MTRR (A66G), ACE (I/D), FII (G20210A), FV (G1691A) и изучение их влияния на развитие инсультов. Нами выявлены различия по частотам генотипов у детей с ИИ и ГИ, что свидетельствует о разном вкладе исследуемых генов в развитие этих типов инсультов и необходимости в дальнейшем их раздельном анализе. В результате проведенного анализа выявлено влияние на развитие ишемических инсультов у детей генотипов 677CТ и 677ТТ гена MTHFR, 1298АС гена MTHFR, 66GG гена MTRR, DD гена ACE и усиление риска в 5 раз при их комбинации. Показано, что на риск развития геморрагических инсультов влияет комбинация генотипов 677СТ и 1298АС гена MTHFR, 1298АС гена MTHFR и ID гена АСЕ. Получена наилучшая статистически значимая 4-локусная модель межгенного взаимодействия при развитии ишемического инсульта у детей, включающая полиморфные варианты MTHFR_C677T/ MTHFR_A1298C/MTRR_A66G/ACE_I/D со 100%-й воспроизводимостью и точностью предсказания 82,34%. У детей с геморрагическим инсультом наилучшей была трехкомпонентная модель со следующей комбинацией генов: MTHFR_C677T/MTHFR_A1298C/ ACE_I/D, ее прогностическая ценность составила 73,94%. Установлено снижение риска (протективный эффект) развития инсультов разного генеза при наличии у детей генотипов 677CC, 1298AA гена MTHFR, 66AA гена MTRR, особенно при их комбинации снижение наблюдается почти в 14 раз. В нашем исследовании не было выявлено достоверного влияния мутаций в генах FII и FV на развитие инсультов у детей украинской популяции.

D) AA/II 10 12,82 17 37,78 10,37 0,23 0,002 0,10–0,57 MTHFR (A1298C) + MTRR (A66G) + ACE (I/D) AA/AA/ <...> D 7/10 56,06 2 MTHFR_C677T/ACE_I/D 8/10 60,20 3* MTHFR_C677T/MTHFR_A1298C/ACE_I/D 10/10 66,93 4* MTHFR_C677T <...> D 5/10 65,09 2 MTRR_A66G/ACE_I/D 6/10 71,47 3* MTHFR_C677T/MTRR_A66G/ACE_I/D 10/10 81,19 4* MTHFR_C677T <...> D) CC + II 2 6,45 20 45,45 11,53 0,08 0,001 0,02–0,39 MTHFR (A1298C) + ACE (I/D) AA + II 3 9,67 17 38,64 <...> D 9/10 62,76 2 MTHFR_C677T/ACE_I/D 7/10 61,53 3* MTHFR_C677T/MTHFR_A1298C/ACE_I/D 10/10 73,94 4 MTHFR_C677T


№2 [Кардиоваскулярная терапия и профилактика , 2013]

Научно-практический рецензируемый журнал. Главный редактор — академик РАН, профессор Оганов Р.Г. Журнал публикует научные статьи по вопросам первичной и вторичной профилактики сердечно-сосудистых заболеваний с помощью различных методов лечения, лекции кардиологов, оригинальные статьи, дискуссии, клинические обзоры и обзоры литературы, рекомендации ВНОК, переводы международных рекомендаций и другую информацию для врачей. Каждый номер журнала формируется ответственным редактором — одним из ведущих специалистов в области кардиологии. Начиная с 2007 года, журнал включен в следующие индексы цитирования: Российский индекс цитирования, Scopus; зарегистрирован в Клубе главных редакторов научных журналов Европейского общества кардиологов. Включен в перечень изданий, рекомендованных для публикации статей, содержащих материалы диссертаций (ВАК).

I/D полиморфизма гена АПФ. <...> allele of the ACE I/D polymorphism. <...> I/D полиморфизма гена AПФ. <...> Д., … Оценка полиморфизма генов липид-транспортной системы и I/D гена при ИБС… генотип D/D гена АПФ и <...> I/D полиморфизма гена AПФ.

Предпросмотр: Кардиоваскулярная терапия и профилактика №2 2013.pdf (0,2 Мб)

Расширение диагностического потенциала централизованной лаборатории при использовании метода иммунофиксации. [Электронный ресурс] / Долгих, Чекмарев // Клиническая лабораторная диагностика .— 2016 .— №9 .— С. 63-64 .— Режим доступа: https://rucont.ru/efd/487040

Автор: Долгих

Централизация лабораторных исследований значительно расширяет диагностический потенциал региона (прежде всего в рамках программы государственных гарантий). При многих заболеваниях встречается нарушение соотношения фракций белков плазмы крови (диспротеинемия). Диспротеинемии наблюдаются чаще, чем изменение общего количества белка, и протеинограммы в динамике могут характеризовать стадию заболевания, его длительность, эффективность проводимых лечебных мероприятий.

Проточная цитометрия (Sysmex UF-1000i) клеточных элементов мочи (лейкоциты, эритроциты, клетки плоского <...> измерение площади моноклонального пика при электрофорезе) для установления стадии симптоматической миеломы (I, <...> мониторинг содержания общего иммуноглобулина E (IgE) в сыворотке крови и детекция полиморфных маркеров I/ <...> D генов детоксикации ксенобиотиков GSTM1 и GSTT1. <...> Детекцию полиморфных маркеров I/D генов GSTM1 и GSTT1 выполняли с применением наборов ГосНИИгенетики


№4 [Российский вестник перинатологии и педиатрии, 2007]

Прежнее название "Вопросы охраны материнства и детства" - один из старейших научно-практических журналов (выпускается с 1956 года). В журнале отражаются современные направления диагностики и лечения заболеваний детского возраста в различных областях медицины: неонатологии и перинатологии; сердечно-сосудистой системы; гастроэнтерологии; нефрологии и урологии; пульмонологии и аллергологии; психоневрологии и др. В издании размещаются статьи дискуссионного и лекционного характера, обзоры литературы и рефераты статей, изданных в зарубежных журналах. Традиционно журнал знакомит читателей с материалами научных конгрессов, съездов и других медицинских форумов, касающихся вопросов перинатологии и педиатрии.

Prenatal diagnosis of urological diseases PSYCHONEUROLOGY Brin I.L., Dunaikin M.L., Voznyakevich S.D. <...> D всего I D абс. % % % абс. % % % Мать 33 34,02 47,05 52,95 17 25,00 28,57 71,43 Отец 31 31,96 46,87 <...> Показатели центральной гемодинамики у больных с разными генотипами полиморфного маркера I/D гена АСЕ <...> Полиморфные маркеры I/D и G7831A гена фермента, превращающего ангиотензин I, и гипертрофия миокарда у <...> Vishnevsky, I.V. Kazanskaya, D.A. Morozov, T.N.

Предпросмотр: Российский вестник перинатологии и педиатрии №4 2007.pdf (0,2 Мб)

№3 [Вопросы наркологии, 2010]

Научно-практический рецензируемый журнал «Вопросы наркологии» был учрежден в 1988 году, как единственное в Российской Федерации специализированное издание, посвященное вопросам профилактики, лечения и реабилитации в наркологии, медико-биологическим проблемам зависимости от психоактивных веществ и нехимическим видам зависимости, вопросам организации наркологической помощи. В журнале размещаются приоритетные данные научно-исследовательских работ, рассказывается о новых лекарственных средствах, психотерапевтических и профилактических программах и технологиях. Функционирует дискуссионная трибуна. Регулярно печатаются научные обзоры, посвященные различным аспектам психиатрии и наркологии, материалы для практикующих врачей, краткие сообщения, а также переводные статьи и рефераты статей, вышедших за рубежом. Учредителями журнала является ФГБУ «Национальный научный центр наркологии» Минздравсоцразвития России и Национальное наркологическое общество. Традиционные разделы журнала: клинико-терапевтические аспекты, биологические, психотерапевтические, профилактические аспекты, психологические, социальные и эпидемиологические аспекты, организация наркологической помощи.

Таким образом, можно предполагать, что при ГРС будут преобладать I-аллели гена АПФ I/D. <...> D пациенты делились на 2 группы (с I-аллелем — II и ID-генотипы и без I-аллеля — DD-генотип). <...> Т174М и I-аллеля гена АПФ I/D и составляет 70% (7 человек из 10). <...> При ТТ-генотипе гена ангиотензиногена Т174М при сочетании его с I-аллелем гена АПФ I/D двухнедельная <...> Распределение пациентов в группах сравнения в зависимости от генотипа АПФ I/D: А — при ГРС (n=35) Б —

Предпросмотр: Вопросы наркологии №3 2010.pdf (0,3 Мб)

Оценка взаимосвязи достижения целевого артериального давления с осложнениями и исходами беременности при артериальной гипертензии [Электронный ресурс] / Чулков В. С., [и др.] // Кардиоваскулярная терапия и профилактика .— 2014 .— №6 .— Режим доступа: https://rucont.ru/efd/285656

Достижение целевого уровня АД у беременных с АГ может быть независимым фактором, влияющим на частоту акушерских осложнений и неблагоприятных исходов беременности. Определенный вклад в достижение целевых уровней АД у беременных с АГ вносят молекулярно-генетические полиморфизмы в генах ренин-ангиотензиновой системы.

полиморфизма гена ACE (I/D) и мутантного С-аллеля полиморфизма гена рецептора 1 типа ангиотензина II <...> of ACE gene (I/D) and mutant C-allele of receptor 1 type angiotensine II gene (ATR1 1166 A/C) comparing <...> Распределение аллелей и генотипов полиморфизмов ренин-ангиотензиновой системы (I/D АСЕ, A1166C ATR1, <...> ACE I/D и мутантного С-аллеля полиморфизма гена ATR1 1166 A/C по сравнению с группой с достижением АД <...> Рис. 1 Распределение аллелей и генотипов полиморфизмов ренинангиотензиновой системы (I/D АСЕ, A1166C


№3 [Артериальная гипертензия, 2015]

Научно-практический рецензируемый журнал, выходящий в печать с января 1995 года и являющийся официальным периодическим изданием Секции артериальной гипертензии Всероссийского научного общества кардиологов и ООО «Антигипертензивная ЛИГА». В журнале «Артериальная гипертензия» публикуются статьи, посвященные широкому спектру современных проблем артериальной гипертензии - от фундаментальных исследований патологических процессов до результатов клинических испытаний новых лекарственных средств и рекомендаций для кардиологов. В журнале публикуются передовые статьи по вопросам современной диагностики, лечения и профилактики артериальной гипертензии, а также результаты отечественных и зарубежных научных исследований в области кардиологии. ИЗДАТЕЛЬ ВЫКЛАДЫВАЕТ НОМЕРА С ЗАДЕРЖКОЙ В 6 МЕСЯЦЕВ!

D), ACE (I/D), eNOS (4a/4b) и MTHFR (С677 Т, Ala222Val, rs1801133). результаты. <...> D), ACE (I/D), eNOS (4a/4b) and MTHFR (C677T, Ala222Val, rs1801133). results. <...> Полиморфизмы генов ADRB1 (Ser49Gly, A/G, rs1801252) ADRA2B (I/D), ACE (I/D), eNOS (4a/4b) и MTHFR (С677 <...> Аллели I и D гена ACE не ассоциированы с относиТаблица 1 вЗаИмОСвяЗь i/d ПОлИмОрФИЗма Гена AdrA2b С ФакТОрамИ <...> Gafarov V, Panov D, Gromova E, Gagulin I, Gafarova A.

Предпросмотр: Артериальная гипертензия №3 2015.pdf (3,0 Мб)


Автор: Иноземцева

Цель: изучить клиническую значимость полиморфизмов rs670, rs662799, rs4341 генов APOA1, APOA5 и ACE соответственно у пациентов с инфарктом миокарда с подъемом сегмента ST (ИМпST). Материал и методы. В исследование включены 358 пациентов, поступивших с диагнозом ИМпST в Кемеровский кардиологический диспансер. Пациентам в течение госпитализации проводились коронароангиография, общий анализ крови, электро- и эхокардиография, получали липидограмму крови, для оценки мультифокального атеросклероза – ультразвуковое цветное дуплексное сканирование брахиоцефальных артерий. На 2–14-е сутки проведен забор крови с последующим генотипированием. Оценивались клинические, лабораторные и инструментальные показатели за период госпитализации. Результаты. Нарушения липидного обмена по данным липидограммы чаще встречались у носителей генотипа CC гена АРОА5. Генотип GG гена АРОА1 ассоциировался с рецидивом инфаркта миокарда (OR = 2,99, 95 % CI = 1,33–6,73, р = 0,006) и другими госпитальными осложнениями (OR = 2,12, 95 % CI = 1,14–3,94, р = 0,02), а также с неблагоприятными показателями липидограммы. Найдена связь аллеля D гена АСЕ с утолщением комплекса интима-медиа сонных артерий (OR = 1,65, 95 % CI = 1,04–2,61). Заключение: некоторые полиморфные варианты генов, ассоциированных с нарушениями липидного обмена и формированием артериальной гипертензии (АСЕ, АРОА1, АРОА5), могут быть использованы для уточнения клинической тяжести и госпитального прогноза у пациентов с инфарктом миокарда.

клиническую тяжесть ИМ, часть из них активно используется в рутинной клинической практике (тропонины I <...> Только изучению полиморфного варианта I/D в 16-м интроне гена посвящено более 1000 работ. <...> f) = 2; P-value 4,26; >0,05 I 346 (72,1 %) 188 (79,7 %) D 134 (27,9 %) 48 (20,3 %) Всего: 480 (100 %) <...> Brown B.G., Zhao X.Q., Sacco D.E. et al. <...> An alternative method for genotyping of the ACE I/D Polymorphism // Mol. Biol. Rep. 2009. Vol. 36.


№6 [Артериальная гипертензия, 2012]

Научно-практический рецензируемый журнал, выходящий в печать с января 1995 года и являющийся официальным периодическим изданием Секции артериальной гипертензии Всероссийского научного общества кардиологов и ООО «Антигипертензивная ЛИГА». В журнале «Артериальная гипертензия» публикуются статьи, посвященные широкому спектру современных проблем артериальной гипертензии - от фундаментальных исследований патологических процессов до результатов клинических испытаний новых лекарственных средств и рекомендаций для кардиологов. В журнале публикуются передовые статьи по вопросам современной диагностики, лечения и профилактики артериальной гипертензии, а также результаты отечественных и зарубежных научных исследований в области кардиологии. ИЗДАТЕЛЬ ВЫКЛАДЫВАЕТ НОМЕРА С ЗАДЕРЖКОЙ В 6 МЕСЯЦЕВ!

McAdam-Marx C., Ye X., Sung J.C., Brixner D.I. et al. <...> Аллелю I соответствовал фрагмент 490 п.н., аллелю D — 190 п.н. <...> Аллель D неблагоприятно влиял на фенотип (табл. 1), однако мы не обнаружили ассоциаций I/D полиморфизма <...> ), в то же время в контрольной группе частоты аллелей I и D были равны (0,500). <...> No association of angiotensin I converting enzyme I/D polymorphism with domain-specifi c cognitive function

Предпросмотр: Артериальная гипертензия №6 2012.pdf (0,4 Мб)

Клинические особенности артериальной гипертензии у детей с DD-генотипом гена ангиотензинпревращающего фермента [Электронный ресурс] / Беляева [и др.] // Кардиология в Беларуси .— 2014 .— №6 .— С. 27-35 .— Режим доступа: https://rucont.ru/efd/492459

Автор: Беляева

Молекулярно-генетический анализ полиморфизма гена ангиотензинпревращающего фермента выявил определенный вклад генотипа DD в реализацию некоторых показателей суточного мониторирования артериального давления и гипертрофию левого желудочка у детей с эссенциальной артериальной гипертензией, что может обуславливать повышенный риск неблагоприятных исходов и более тяжелое течение заболевания по сравнению с носительством других генотипов

отсутствием (deletion-D) Alu-повтора длиной 287 пн, так называемый I/Dполиморфизм. <...> На базе Института генетики и цитологии НАН Беларуси методом ПЦР проводили определение I/D-полиморфизма <...> Так, известно, что у носителей аллеля D гена АСЕ более высокое АД, чем у носителей аллеля I, что является <...> При оценке ассоциации I/D полиморфизма гена АСЕ с основными эхокардиографическими параметрами выявлено <...> Angiotensin I-converting enzyme (ACE): A review of I/D polymorphism in the world populations / K.


№4 [Вопросы гинекологии, акушерства и перинатологии, 2017]

Научно-практический журнал выпускается с 2002 г. и предназначен для акушеров-гинекологов, в том числе узких специальностей (радиология, эндоскопия, химиотерапия), и перинатологов. Журнал входит в Международную реферативную базу Scopus и в Перечень ведущих научных журналов и изданий ВАК, в которых должны быть опубликованы основные результаты диссертаций на соискание ученой степени кандидата и доктора наук Журнал индексируется в реферативной базе данных Ulrich's Periodicals Directory и в Российском индексе научного цитирования. Журнал публикует оригинальные исследования, обзоры литературы, лекции, методические рекомендации, клинические наблюдения.

e n t i f i c a n d P r a c t i c a l J o u r n a l A.Acosta, prof. <...> D.N.Protsenko, PhD V.E.Radzinskiy, corr. member of RAS I.I.Ryumina, PhD, prof. <...> e n t i f i c a n d P r a c t i c a l J o u r n a l Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис <...> Полиморфизм I/D гена АСЕ связан с риском развития ПЭ. <...> Заключение Полиморфизм I/D гена АСЕ связан с риском развития ПЭ.

Предпросмотр: Вопросы гинекологии, акушерства и перинатологии №4 2017.pdf (0,2 Мб)

Анализ вклада полиморфизма некоторых кандидатных генов в развитие артериальной гипертензии и ремоделирование миокарда на примере сибсовых пар [Электронный ресурс] / Хасанов, Ослопов, Сломинский // Артериальная гипертензия .— 2011 .— №5 .— С. 88-92 .— Режим доступа: https://rucont.ru/efd/347645

Автор: Хасанов

Цель исследования. Оценивался вклад генов ренин-ангиотензиновой системы, липидного обмена и генов- регуляторов апоптоза в развитие гипертонической болезни и ремоделирование миокарда с использованием сибсового и ассоциативного методов. Материалы и методы. Масса миокарда и индекс массы миокарда вычислялся при помощи эхокардиографического исследования, полиморфизм генов определялся методом полимеразной цепной реакции. Результаты. Выявлена ассоциация генотипа М235М гена AGТ с гипертонической болезнью у представителей татарского этноса. Генотип A603A гена EAAT2 был ассоциирован с более высоким уровнем систолического артериального давления, а генотип CC rs189994 гена AIF — с большей массой миокарда в группе больных гипертонической болезнью.

Всем обследованным определялся M235T полиморфизм гена ангиотензиногена (AGТ), I/D полиморфизм гена ангиотензинпревращающего <...> Zintzaras E., Kitsios G., Stefanidis I. <...> Timberlake D.S., O’Conner D.T., Parmer R.J. <...> Curtis D., Miller M.B., Sham P.C. <...> Sullivan J.M., Prewitt R.I., Josephs J.A.


Проектирование схем электрических принципиальных с использованием LCD-дисплеев и светодиодных матриц в программной среде Proteus 8.1. Часть 1 [Электронный ресурс] / М. Филатов // Компоненты и технологии .— 2017 .— №4(189) .— С. 114-122 .— Режим доступа: https://rucont.ru/efd/597049

Автор: Филатов Максим

В Proteus реализовано большое количество функций для профессионального проектирования микроэлектронных устройств, ориентированных на самые современные средства моделирования. Одной из таких функций является имитация работы устройств вывода информации. В статье рассматриваются компоненты библиотек светодиодных точечных матриц, буквенно-цифровых и графических LCD-дисплеев, описаны общие аспекты и приведены примеры моделирования схем с использованием этих компонентов в Proteus. Первая часть статьи посвящена описанию работы с буквенно-цифровыми дисплеями на примере микросхемы LM016L (в 8-разрядном режиме)

в нулевую позицию 0 0 0 0 0 0 0 1 – Выбор направления сдвига курсора при записи следующего символа (I/ <...> D — 1 сдвиг вправо, I/D — 0 сдвиг влево); Разрешение или запрет сдвига экрана (S — 1 сдвиг разрешен, <...> S — 0 сдвиг запрещен) 0 0 0 0 0 0 1 I/D S Включить/выключить дисплей (D — 1 дисплей включен, D — 0 дисплей <...> I 01001001 i 01101001 J 01001010 j 01101010 K 01001011 k 01101011 L 01001100 l 01101100 M 01001101 m <...> сигналов широкого диапазона популярных встраиваемых и автомобильных последовательных шин, в том числе I2C


№3 [Клиническая лабораторная диагностика, 2014]

Основан в 1955 г. Главный редактор – Титов Владимир Николаевич, доктор медицинских наук, профессор, заведующий лабораторией клинической биохимии липидного обмена ФБУН «Российский кардиологический научно-производственный комплекс» Минздрава России. Журнал издается как ежемесячное профессиональное научно-практическое издание с 1955 г. (до 1992 г. под названием «Лабораторное дело»). На протяжении многих лет журнал был основным источником научной и практической информации для сотрудников клинико-диагностических лабораторий и играл роль стимула совершенствования лабораторного обеспечения медицинской помощи. Журнал публикует научные и практические материалы, подготовленные сотрудниками научных, образовательных и лечебных учреждений России и зарубежных стран: оригинальные статьи, обзоры литературы, лекции видных специалистов разных дисциплин лабораторной медицины, описания сложных клинико-диагностических случаев заболеваний, информации о научно-практических мероприятиях, дискуссии между сторонниками разных подходов к решению актуальных проблем, ответы ученых и организаторов здравоохранения на насущные вопросы практиков лабораторного дела. Осуществляет публикацию переводов статей зарубежных авторов, представляющих наибольший научно-практический интерес для специалистов в нашей стране и опубликованных в профессиональной научной литературе за рубежом(в частности, в журнале «Clinical Chemistry», с которым заключено соответствующее соглашение).

MALACHOV (Moscow), D.D. MEN'SHIKOV (Moscow), V.I. NIGULYANU (Kishinev), E.N. <...> PERVUCHIN (Stavropol'), I.V. PICALOV (Novosibirsk), Yu.P. REZNICOV (Moscow), D.B. <...> M a i l i n g a d d r e s s : Izdatelstvo "MEDITSINA" 17A, building 1B, Verhnaya Krasnoselskaya street <...> I.Yu., Tereshina D.S., Kotlovskiy Yu.V., Titov V.N. <...> Kotlovskiy, D.A. Kiritchenko, I.Yu. Yakimovitch, D.S. Tereshina, Yu.V. Kotlovskiy, V.N.

Предпросмотр: Клиническая лабораторная диагностика №3 2014.pdf (12,2 Мб)

Делеционный полиморфизм генов глутатионтрансфераз T1 и M1 у пациентов с инфарктом миокарда и метаболическим синдромом [Электронный ресурс] / Невзорова В. А., Панченко Е. А., Исаева М. П. // Кардиоваскулярная терапия и профилактика .— 2014 .— №3 .— Режим доступа: https://rucont.ru/efd/264695

Автор: Невзорова В. А.

Определение наличия гомозиготной делеционной мутации GSTT1 может использоваться для индивидуального прогноза возникновения ИМ у пациентов с факторами риска — МС и курением.

Исходя из цели исследования, выделены 2 группы: I группа (n=41) без признаков МС, II группа (n=45) с <...> D гена GSTM1 и I/D гена GSTT1 производства “ГосНИИгенетика” (Россия). <...> По возрастному показателю и полу I и II группы достоверно между собой не различались. <...> Достоверного различия в показателях АД между I и II группами обследованных не установлено (р>0,05). <...> III ФК ОСН преобладал у пациентов II группы, IV — чаще у пациентов I группы (17% vs 3%).

Страницы: 1 2 3 ... 5524