Национальный цифровой ресурс Руконт - межотраслевая электронная библиотека (ЭБС) на базе технологии Контекстум (всего произведений: 570286)
Консорциум Контекстум Информационная технология сбора цифрового контента
Уважаемые СТУДЕНТЫ и СОТРУДНИКИ ВУЗов, использующие нашу ЭБС. Рекомендуем использовать новую версию сайта.
  Расширенный поиск
Результаты поиска

Нашлось результатов: 32454 (0,88 сек)

Свободный доступ
Ограниченный доступ
Уточняется продление лицензии
51

Журналистика: сборник учебных программ. Часть 4

[Б.и.]

Профили подготовки «Телевидение и радиовещание», «Международная журналистика», «Спортивная журналистика», «Музыкальная журналистика», «Журналистика в социально-культурной сфере», «Литературно-художественная критика»

Исследование эффективности PR-деятельности: цели и этапы эффективности PR-программ. <...> Пресс-клиппинг как PR технология. Роль PR в государственной системе. <...> Соотношение понятий и функций: PR и реклама, PR и пропаганда, PR и маркетинг. 3. <...> PR в России больше чем PR: Технологии и версии. – М., 2001. – 285 с. Маслова В.М. <...> PR в России больше чем PR: Технологии и версии. – М., 2001. – 285 с. Музыкант В.Л.

Предпросмотр: Журналистика. Сборник учебных программ. Часть 4.pdf (0,8 Мб)
52

Попов, А.А. Метастазы рака молочной железы в печень после химиоэмболизации печеночной артерии: новые критерии оценки объективного ответа / А.А. Попов, Н.Ф. Поляруш, Г.С. Козупица // Медицинская визуализация .— 2016 .— №3 .— С. 124-134 .— URL: https://rucont.ru/efd/502643 (дата обращения: 28.09.2021)

Автор: Попов

Цель исследования: разработка критериев оценки эффективности лечения метастазов рака молочной железы в печень методом химиоэмболизации печеночной артерии, основанных на расчете изменения объема опухолевой ткани в метастатических очагах, и сравнение полученных критериев с критериями RECIST Материал и методы. Проанализированы данные компьютерной томографии, проведенной до и после лечения у 21 больной с метастатическим поражением печени. Результаты лечения оценивались для каждого пациента согласно критериям RECIST и показателю кинетики роста опухоли (величина, обратная времени удвоения, RDT). Проводился сравнительный анализ данных объективного ответа, определенного двумя названными способами.

Б., 50 лет 91 91 24 −43,56 −8,38 74,47129 PR SD К., 52 года 100 119 21 −43,83 −8,33 77,80692 PR SD Ч <...> ., 54 года 115 97 22 −52,49 −6,95 76,29151 PR SD Ш., 51 год 41 93 59 −53,13 −6,87 35,74802 PR SD Ч., <...> 63 года 153 71 17 −59,52 −6,13 82,01046 PR SD Ю., 40 лет 99 110 38 −70,70 −5,16 58,08822 PR SD Т., 52 <...> года 191 89 16 −71,25 −5,12 83,3967 PR SD У., 41 год 84 96 47 −76,82 −4,75 48,11279 PR SD Л., 41 год <...> 142 84 −350,57 −1,04 12,08922 PR PD А., 33 года 99 90 83 −364,10 −1,00 13,22913 PR SD А., 59 лет 132

53

№8 [Законность, 2002]

Как известно, в последние полтора десятилетия в России активно обновляется законодательство, по некоторым вопросам – кардинально, многие правовые институты претерпевают существенные изменения, вводятся новые. На страницах журнала за это время опубликовано много дискуссионных статей о месте и роли прокуратуры в нашем обществе и государстве, посвящённых судебной реформе, новому УПК, суду присяжных, реформе следствия в прокуратуре и т. д. Но это никогда не было в ущерб материалам об обмене опытом и комментариям законодательства, сложных вопросов правоприменительной практики. Регулярно публикуются и очерки о заслуживших признание прокурорах. У журнала есть сложившийся авторский коллектив, куда входят и известные учёные, и болеющие душой за дело работники правоохранительных органов практически из всех регионов России.

.)*(,.0)�)+7H� -+� -+1-*0)1R0� M.7+PR� / )0'� G)+PR K/).1+,()H� 30O/),()07H1+� 7( PR7( 3+FKQ01R�1. <...> /0� U)+� 10+PI+3('+� 37N� )+L+� G)+PR *+//(N10� 1.KG(7(/H L*. <...> � G)+PR +P0/F0G()H ,RF+7101(0� F*. <...> �PR7.�*.W*.P+).� 1.� S07.N� /(/)0'. <...> '� PR7+� PR� S070/++P*.W1+ W.9(-/(*+,.)H� G)+�F*+-K*.)K*.

Предпросмотр: Законность №8 2002.pdf (0,1 Мб)
54

Методика обучения студентов неязыковых вузов написанию PR-текстов

Автор: Подкаменная Елизавета Васильевна
Бурятский государственный университет

В реферируемой диссертации обосновывается методическая система обучения студентов старших курсов профессионально ориентированной иноязычной письменной речи, разрабатывается типология аутентичных пресс-релизов, разрабатывается технология обучения специфическим механизмам создания PR-текстов.

правах рукописи Подкаменная Елизавета Васильевна МЕТОДИКА ОБУЧЕНИЯ СТУДЕНТОВ НЕЯЗЫКОВЫХ ВУЗОВ НАПИСАНИЮ PR-ТЕКСТОВ <...> Однако исследования PR-текста с позиций лингводидактики на данный момент практически отсутствуют, за <...> на русском языке; не разработана методическая типология различных видов англоязычных PR-текстов. <...> Шишкина и др.) показал, что единой типологии PR-текста на сегодняшний день не существует. <...> Таблица №1 Виды PR-текстов в профессиональной сфере рекламы и связей с общественностью Англоязычные PR-тексты

Предпросмотр: Методика обучения студентов неязыковых вузов написанию PR-текстов.pdf (0,4 Мб)
55

Кочетова, В.С. PR-текст как способ формирования имиджа корпорации / В.С. Кочетова // Вестник Московского университета. Серия 10. Журналистика .— 2010 .— №2 .— С. 179-190 .— URL: https://rucont.ru/efd/378616 (дата обращения: 28.09.2021)

Автор: Кочетова

О жанрах PR-текста.

Рассматриваются особенности целевых аудиторий PR-текстов. <...> Features of target audiences of PR-texts are considered. <...> Разнообразие PR-текстов PR-текст — разновидность текстов массовой коммуникации, письменный текст на бумажном <...> Кривоносов в своей работе “PR-текст в системе публичных коммуникаций” классифицирует PR-тексты по степени <...> Профессиональный PR-специалист должен владеть всеми жанрами PR-текстов, а также уметь подготовить журналистский

56

Хромов, А.В. СТРОЕНИЕ И СВОЙСТВА ОРГАНИЧЕСКИХ ПИГМЕНТОВ / А.В. Хромов, В.А. Смрчек // Лакокрасочные материалы и их применение .— 2010 .— №11 .— С. 27-35 .— URL: https://rucont.ru/efd/408828 (дата обращения: 28.09.2021)

Автор: Хромов

Прародители пигментных лаков — текстильные протравные красители. Крашение по протраве известно с древнейших времен, процесс крашения заключался в обработке ткани протравой, например растворимой солью кальция, алюминия, хрома или какого-либо другого металла, затем ткань обрабатывалась раствором вещества, образующего при взаимодействии с этими солями нерастворимый краситель.

49:1 15630:1 – – – – Ba 3–5 4–5 4 4 4–5 PR 49:2 15630:2 – – – – Ca 5–6 5 4 4 4 PR 50 15500 СОО– – – <...> – PR 69 15595 SO 3 – CH 3 Cl – Са 4 5 – – – PR 70 15590 SO 3 – CH 3 – – Са 4 5 5 5 – PR 99 15570 CH 3 <...> 2–3 5 3 3 – 4 PR 63:2 15880:2 Ва 5 5 3 2 5 3–4 – – 5 PR 243 – – – – Са 5–6 5 4 5 5 5 3 4 5 PR 247:1 <...> 172 45430:1 2 – – – – – – – – PR 173 45170:3 – – – – – – – – – PR 174 – – – – – – – – – – PR 191 45425 <...> :1 3 5 4 5 1 5 – 1 1 PO 39 PR 172Food Red 14:1 PR 173 PR 174 PR 191 45370:1 45430:1 45170:3 – 45425:1

57

PR-технологии в спортивном менеджменте метод. рекомендации, задания и учеб. материал для практ. занятий

Автор: Логинова Ольга Александровна
М.: РГУФКСМиТ

Целью самостоятельной работы магистрантов является овладение фундаментальными знаниями, профессиональными умениями и навыками практической и исследовательской деятельности по направлению 49.04.01 «Физическая культура». Самостоятельная работа магистрантов способствует развитию самостоятельности, ответственности и организованности, творческого подхода к решению проблем учебного и профессионального уровня.

Подготовка исходных сведений о PR-объекте. 2. <...> Разработка PR-стратегии. 11. Прогнозирование результатов проведения PR-кампании. <...> PR на 100%: Как стать хорошим менеджером по PR. – М.: Альпина Паблишер, 2003. 6. Грин Э. <...> вокруг нас 3 http://www.marketingist.ru/pr -technology/ Теория маркетинга, бренды, PR-технологии PR-технологии <...> / http://www.marketingist.ru/pr-technology/

Предпросмотр: PR-технологии в спортивном менеджменте.pdf (0,3 Мб)
58

Сиушкин, А.Е. К ВОПРОСУ ОБ ОСОБЕННОСТЯХ ПОЛИТИЧЕСКОЙ PR-КОММУНИКАЦИИ / А.Е. Сиушкин, О.В. Милаева // Наука. Общество. Государство .— 2015 .— №1 .— С. 184-196 .— URL: https://rucont.ru/efd/552765 (дата обращения: 28.09.2021)

Автор: Сиушкин

В современном политическом и научном дискурсе вопрос о выстраивании диалога власти и общества на основе увеличения информационной открытости и прозрачности принятия политических решений является одним из самых актуальных. Авторы обращаются к анализу данной темы с точки зрения использования возможностей политических PR-технологий, утверждая, что они, в силу своей специфики, имеют потенциальную возможность оптимизации информационной составляющей политического процесса в целом. Авторами последовательно рассматривается политическая коммуникация и политический PR как процессы, политические технологии и особенности электоральной PR-коммуникации как инструменты реализации политической коммуникации. Акцент в авторском изложении делается на выявлении специфических особенностей всех элементов политической коммуникации. Особое внимание авторами статьи уделяется рассмотрению электоральной коммуникации, напрямую связанной с широким применением PR-технологий. В статье выделены не только особенности электоральной PR-коммуникации, но и предпринята попытка построения модели PR-технологии. Она представлена авторами как ряд нисходящих элементов PRпланирования

модели PR-технологии. <...> Ключевые слова: политический процесс, политическая коммуникация, политический PR, PR-технологии, электоральный <...> Key words: political process, political communication, political PR, PR-technologies, the electoral process <...> Политический PR с технологической точки зрения мало чем отличается от PR в других сферах. <...> В-пятых, политические PR-технологии это самый медиатизированный из всех видов PR -коммуникации.

59

№3 [Моделирование и анализ информационных систем (МАИС), 2011]

Научный журнал Моделирование и анализ информационных систем издается Ярославским государственным университетом им. П.Г. Демидова. В журнале публикуются статьи по математике и информатике, вычислительной технике, кибернетике, механике и управлению, в которых рассматривается широкий круг вопросов, связанных с разработкой, анализом и проектированием информационных систем, а также исследованием их математических моделей. Входит в перечень ВАК.

(pr1(z∗) ∈ K)⇒ (pr2(z∗) ∈ K). (35) Åñëè æå pr1(z∗) = p, òî èñòèííà èìïëèêàöèÿ (pr2(z∗) ∈ 1, N \K)⇒ ( <...> Ïîýòîìó ïðè óñëîâèè pr1(λ) = pr2(ρ) íåïðåìåííî pr2(λ) ∈ K è, â ÷àñòíîñòè, pr2(λ) ∈ K (ñì. (53)). <...> 6= pr2(ρ), òî åñòü pr1(ρ) /∈ {pr2(ρ)}. <...> pr1(l∗) ∈ K \ {pr2(ρ)}. <...> (λ) 6= pr2(λ), à òîãäà, ïîñêîëüêó n = pr2(λ), pr1(λ) 6= n, è (ñì. (84)) pr1(λ) ∈ K.

Предпросмотр: Моделирование и анализ информационных систем (МАИС) №3 2011.pdf (0,6 Мб)
60

Демьяненко, Л.В. ПРОДВИЖЕНИЕ ПО РАСЧЕТУ / Л.В. Демьяненко // Креативная экономика .— 2013 .— №5 .— С. 105-111 .— URL: https://rucont.ru/efd/539176 (дата обращения: 28.09.2021)

Автор: Демьяненко Людмила Владимировна

Проблема оценки эффективности PR-активности на этапе планирования особенно актуальна с точки зрения экономической целесообразности. Отсутствие методологии оценки эффективного финансового вложения в PR-акции просматривается не только в научно-исследовательской деятельности, но и в нежелании применять данный финансовый рычаг управления в практике компаний. Возникает потребность в выявлении факторов, затрудняющих финансовый анализ эффективности применения PR-кампании в сфере услуг (в бизнесе в целом), и разработке методологии оценки PR-деятельности

103 Проблема проведения PR-кампаний в мало-форматном бизнесе, особенно в сфере услуг, непосредственно <...> связана с отсутствием методики оценки эффективности применения PR. <...> PR в нашей стране чаще применяется в политике. <...> PR-коммуникации: Практическое пособие / И.П. Бердников, А.Ф. <...> Книга руководителя отдела PR. – СПб.: Питер, 2006. – 368 с. 4. Щербаков А.И.

61

Оперативное управление ЖКХ учеб. пособие

М.: Проспект

Реформирование жилищно-коммунального хозяйства идет полным ходом. Меняется система, меняется законодательство в жилищной сфере. На сегодняшний день наиболее значимыми вопросами являются такие, как управление многоквартирными домами и взаимодействие с собственниками в них, организация и проведение капитального ремонта общего имущества многоквартирных домов и лицензирование деятельности по управлению многоквартирными домами. Для того чтобы помочь разобраться в этих непростых, но актуальных вопросах, а также в основах жилищного законодательства и научиться применять его на практике, специалистами в сфере жилищно-коммунального хозяйства разработано данное учебное пособие.

Основные понятия и определения PR-деятельности Словосочетание public relations (PR) и фонетический русский <...> Наиболее перспективное развитие PR сейчас — это его развитие в Интернете, или e-PR. <...> Как и любой другой вид PR, электронный PR служит задачам информирования аудитории, нахождения взаимопонимания <...> Для иллюстрации опыта решения задач PR в организациях отрасли далее приведены примеры PR-деятельности <...> PR для Интернета, Интернет для PR // MOST Marketing. 2006. 19 cент.

Предпросмотр: Оперативное управление жилищно-коммунальным хозяйством. Учебное пособие.pdf (0,1 Мб)
62

Алехина, М.А. Синтез асимптотически оптимальных по надежности неветвящихся программ в базисе {x[1]vx[2], x[1]&x[2], x{-}[1], stop} / М.А. Алехина, С.М. Зиновьева // Известия высших учебных заведений. Поволжский регион. Физико-математические науки .— 2009 .— №2 .— С. 60-67 .— URL: https://rucont.ru/efd/269821 (дата обращения: 28.09.2021)

Автор: Алехина
М.: ПРОМЕДИА

Рассматривается задача синтеза асимптотически оптимальных по надежности неветвящихся программ с условной остановкой, реализующих булевы функции, при инверсных неисправностях на выходах операторов в базисе {x[1]? x[2], x[1]&x[2], x{-}[1], stop}. Доказано, что в рассматриваемом базисе все булевы функции f (x[1], x[2],..., x[n]) можно реализовать асимптотически оптимальными по надежности программами с условной остановкой, причем для функций x[i] (i принадлежит множеству {1, 2,..., n}) эти программы являются абсолютно надежными (не содержат операторов), а для остальных функций эти программы функционируют с ненадежностью, асимптотически равной ? при ? > 0 (? - вероятность инверсной неисправности на выходе оператора).

Ненадежностью N(Pr) программы Pr назовем максимальную вероятность ошибки на всех выходах программы Pr <...> I0P : I 0 ( , )gP Pr a = ε · ε = ε 2; – вероятность II0P : II 0 ( , )gP Pr a = 1 – ε + ε 2 – 2ε + <...> I1P : I 1 ( , )gP Pr a = (1 – ε) 2; – вероятность II1P : II 1 ( , )gP Pr a = 1 – ε + ε 2 – ε + 2ε2 <...> Тогда 1( , )fP Pr a ≤  + 21 2. <...> Тогда 0 ( , )fP Pr a ≤  + 4 2.

63

Гусев, С.А. Исследование теплового состояния отсеков пассажирского самолета с сотовыми конструкциями фюзеляжа / С.А. Гусев, В.Н. Николаев // Научный вестник Новосибирского государственного технического университета .— 2016 .— №1 .— С. 146-167 .— URL: https://rucont.ru/efd/610321 (дата обращения: 28.09.2021)

Автор: Гусев

Разработан метод определения теплового состояния отсеков самолета, основанный на использовании математической модели теплового состояния отсеков. Математическая модель системы герметичного теплоизолированного отсека с системой кондиционирования воздуха и негерметичных нетеплоизолированных отсеков представлена системой одномерных уравнений теплоизолированной обшивки окон, а также обыкновенных дифференциальных уравнений конвективного теплообмена внутренней поверхности теплоизоляции обшивки в теплоизолированных отсеках и внутренней поверхности обшивки в нетеплоизолированных отсеках, кресел, людей, багажа или груза, бортового оборудования, воздуха и переноса энтальпии из системы кондиционирования воздуха. Коэффициент лучистого обмена в модели определяется методом Монте-Карло. Проведена разработка методов решения прямой и обратной задач теплообмена и определения доверительных интервалов оценок параметрической идентификации. Доверительные интервалы оценок коэффициентов нелинейной математической модели теплового состояния отсека определены с помощью ковариационной матрицы ошибок оценок искомых коэффициентов модели. При этом используется метод проецирования совместной доверительной области оценок на координатные оси пространства коэффициентов. В качестве объекта исследования был принят прототип бразильского магистрального самолета Embraer 190. Исследования проводились в соответствии с Нормами летной годности. Получены потребные характеристики системы кондиционирования воздуха и системы вентиляции, а также толщины теплоизоляции в кабине экипажа и салоне пассажиров.

bl x bl pr bl pr air pr blx T F T t F T t T t x     4 4 4, , , 0 , ,/ ( ), ;j bl pr bl j ms bl <...> pr bl pr bl j g T T c F T t x l    (7) 0(0, ) ( ), 0 ,blT x T x x l   (8) где , 0 ,1( ) , ( , <...> t cv in cv in pr air cv in pr cv pr air pr bl pr bl pr air bl pr bl pr air pr air r air r air r air <...> ,( ( ) / ( ( ) ) / ( ),air j air j air j air pr p stm air stm air pr j t F C T t T c G C T T    <...> bl pr air bl pr bl pr air upr air p air p air p air upr p air p air m air m air m air upr T t F C T

64

Корпоративная финансовая политика монография

Автор: Когденко В. Г.
М.: ЮНИТИ-ДАНА

В монографии представлены теоретические и методические аспекты формирования корпоративной финансовой политики на основе ценностно-ориентированного менеджмента. Исследованы основные аспекты формирования краткосрочной и долгосрочной финансовой политики. Представлена современная финансовая модель корпорации, ориентированная на стратегический анализ бизнеса и обоснование корпоративной финансовой политики, направленной на увеличение стоимости. Ключевые алгоритмы проиллюстрированы тематическими исследованиями (Case Study), выполненными на основе консолидированной финансовой отчетности реальной корпорации.

. , , : 0f PR f PRFA FA I DA . : : 0N PR N PRFA FA I DA , 0FA – . : PR PROE TR ORC . : PR PR PR PR PR <...> PR PR eT EBT t . ( ) PR PR PRNP EBT T . , : PR PR KRP NP k . , – ( ). . : ; ( – ); ; , . , , – , , ; <...> C P T . – : PR N PR PR PR PRB FA INV AR C . . , . , , : 0A PR A PRE E RP , 0EN – . : PR PR AP C TR AP <...> PR PR p PRPS LC t LC , PRLC – ; pt – . , , : PR PR PR p PRPT SE T t LC . , : PR PRPO OE . <...> PR PR PR PRCFF LD SD PD . , PR PR PR PRCF CFO CFI CFF . – , , Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство

Предпросмотр: Корпоративная финансовая политика. Монография. Гриф УМЦ Профессиональный учебник. Гриф НИИ образования и науки. (Серия Magister)..pdf (0,2 Мб)
65

№3 [Вестник социально-гуманитарного образования и науки, 2017]

Публикуются статьи, обзоры и другие авторские материалы, представляющие научный и практический интерес по проблематике журнала. Основные рубрики журнала: · «Социально-гуманитарные исследования»; · «Социально-гуманитарные технологии»; · «Социально-гуманитарное образование».

Относительно последнего PR-инструмента, как отмечает А. Е. <...> Далее представим результаты оценки эффективности PR-мероприятия. <...> PR: теория и практика [Текст] / Д. Е. Баранов, Е. В. Демко, М. А. <...> Все о PR. <...> Технологии и методы PR-продвижения информационных ресурсов.

Предпросмотр: Вестник социально-гуманитарного образования и науки №3 2017.pdf (0,2 Мб)
66

Ватедка, Ш. НЕКОТОРЫЕ “ХОРОШИЕ” СВОЙСТВА МПА-РЕШЕТОК / Ш. Ватедка, Н. Кашьяп // Проблемы передачи информации .— 2017 .— №1 .— С. 4-34 .— URL: https://rucont.ru/efd/593052 (дата обращения: 28.09.2021)

Автор: Ватедка

Изучаются некоторые структурные свойства решеток, получаемых с помощью конструкции A из кодов с малой плотностью проверок над простыми полями. Такие решетки, называемые МПА-решетками, позволяют проводить декодирование с пересчетом апостериорных вероятностей (“распространения доверия”) при передаче информации по гауссовским каналам. Известно, что МПАрешетки позволяют достичь пропускной способности канала с аддитивным белым гауссовским шумом (АБГШ-канала) с ограничением на мощность сигнала при декодировании в ближайшую точку решетки, а результаты моделирования позволяют предположить, что они также дают хорошие результаты при декодировании с пересчетом апостериорных вероятностей. Продолжая это направление исследования, мы доказываем, что эти решетки хороши также для задач упаковки и среднеквадратичной ошибки квантования, а двойственные к ним решетки – для задачи упаковки. Таким образом, коды, построенные по вложенным МПА-решеткам, достигают пропускной способности АБГШ-канала с ограничением на мощность, пропускной способности канала типа “грязная бумага”, скоростей, гарантированных протоколом compute-and-forward, а также наилучших известных скоростей двусторонней ретрансляции с совершенной секретностью

Для любого γ > 0 получаем E[G(Λ)] � 1 2πe Pr [ 1 2πe < G(Λ) � 1 2πe + γ ] + ( 1 2πe + γ ) Pr [ G(Λ) > <...> 1 2πe + γ ] = = 1 2πe ( 1− Pr [ G(Λ) > 1 2πe + γ ]) + ( 1 2πe + γ ) Pr [ G(Λ) > 1 2πe + γ ] = = 1 2πe <...> + γ Pr [ G(Λ) > 1 2πe + γ ] , и следовательно, Pr [ G(Λ) > 1 2πe + γ ] � E[G(Λ)]− 1/(2πe) γ . <...> /n ∣∣∣ H полного ранга]Pr[H полного ранга] + +EΛ,X [ d2(X,Λ) n(vol(Λ))2/n ∣∣∣ H не полного ранга]Pr[H <...> Поэтому Pr[d(x,Λ) > ρ] = Pr[Xρ = 0] � Pr[Xρ � 0] = Pr [ Xρ −E[Xρ] � −E[Xρ] ] � � Pr [ |Xρ −E[Xρ]| � E

67

Отис, О. Местные знаменитости / О. Отис // RUБЕЖ .— 2016 .— №2 (16) .— С. 104-106 .— URL: https://rucont.ru/efd/481862 (дата обращения: 28.09.2021)

Автор: Отис Ольга

Журнал RU5EЖ продолжает следить за популярностью топ-брендов видеонаблюдения в интернете, в российских городах-миллионниках. Полагаем, что результаты этих наблюдений помогут продавцам уточнить маркетинговые цели, а вендорам — скорректировать маршруты роуд-шоу, если таковые запланированы на этот год.

RV i Ax is H ik vi si on Fa lc on E ye LT V CT V Be w ar d eV id en ce D ah ua G ra nd st re am CN B PR <...> ta rc am AC Ti Po ly vi si on Be st D VR M ic ro di gi ta l Ja ss un J2 00 0 H iW at ch N ov ic am Pr <...> ta rc am CN B D ah ua G ra nd st re am Sm ar te c IT V | A xx on So ft Ac tiv eC am Та хи он AC Ti PR <...> O vi si on H iW at ch Pe lc o Po ly vi si on Be st D VR Pr ax is CT V Sp ez vi si on M ic ro di gi ta <...> A xx on So ft AC Ti H iW at ch N ov ic am VS ta rc am Ac um en D ah ua G ra nd st re am Sm ar te c PR

68

Программа итоговой государственной аттестации выпускников специальности 030602.65 «Связи с общественностью» учеб.-метод. пособие

Изд-во ПГУТИ

Учебно-методическое пособие и программа государственного экзамена разработаны на основании Государственного образовательного стандарта высшего профессионального образования специальности 030602.65 «Связи с общественностью». Программа государственного экзамена рассчитана на выпускников специальности «Связи с общественностью» дневной и заочной форм обучения. Пособие поможет студентам подготовиться к государственному экзамену и показать освоенный уровень теоретических и практических знаний.

PR на 100%: Как стать хорошим менеджером по PR. М.: Альпина Бизнес Букс, 2004. 16. Гофман И. <...> и анализу PR-кампаний http://www.prt.ru Коммуникационное агентство «PR-technologies» http://www.rakours-pr.ru <...> /PR_Lib PR-библиотека на сайте агентства «Международный Пресс-клуб. <...> http://www.pr-news spb.ru газета «PR-news». <...> /uk Интернет-версия одного из крупнейших изданий о PR «PR-Week» http://www.publicrelations.at сайт PR-союза

Предпросмотр: Учебно-методическое пособие и программа государственного экзамена разработаны на основании Государственного образовательного стандарта высшего профессионального образования специальности 030602.65 «Связи с общественностью».pdf (0,2 Мб)
69

Дыкин, Р.В. МЕТАМОРФОЗЫ СОЦИАЛЬНОЙ РЕКЛАМЫ В РОССИИ: ОТ ПУБЛИЦИСТИЧНОСТИ К ПАБЛИЦИТНОСТИ / Р.В. Дыкин // Вестник Воронежского государственного университета. Серия: Филология. Журналистика. .— 2008 .— №2 .— С. 186-192 .— URL: https://rucont.ru/efd/523023 (дата обращения: 28.09.2021)

Автор: Дыкин

Исследование роли и функций социальной рекламы в системе массовой коммуникации, а также тенденций взаимодействия социальной рекламы, публицистической коммуникации и PR-коммуникации

«приращению паблицитного капитала базисного PR-субъекта» [10, 12]. <...> рассматриваться как средство, а также как результат PR. <...> журналистских и PR-задач; PR-сообщение, в свою очередь, – нести рекламный заряд, заимствуя жанровую <...> Жанры PR-текста: Учебное пособие / А.Д. <...> Паблик рилейшнз (PR) в системе массовой коммуникации / В.В.

70

Связи с общественностью в органах власти : учебное пособие

РИО СамГАУ

Учебное пособие включает в себя основные вопросы теории и практики связей с общественностью в государственных и муниципальных органах власти на этапе развития российского государства, учитывающие акту-альные теоретические и практические аспекты и проблемы в нынешнем функционировании института Public Relations в структурах государ-ственного и муниципального управления. Изложенные темы охватывают практически весь спектр направлений, изучаемых в данной дисциплине, дополнены конкретными практическими примерами, позволяющими лег-че усвоить предлагаемый материал.

Базовые документы PR. <...> » б) «желтых PR» в) «коричневых PR» г) «серых PR» Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис <...> PR-задачами 2. <...> PR в деятельности силовых структур. 4. PR в Интернете. 5. <...> Внешнеполитическая пропаганда и PR. 19. Невербальные коммуникации и PR. 20.

Предпросмотр: Связи с общественностью в органах власти учебное пособие .pdf (1,0 Мб)
71

Корабельщикова, С.Ю. Об общем корне элементов глобального надмоноида / С.Ю. Корабельщикова, Б.Ф. Мельников // Вестник Северного (Арктического) федерального университета. Серия 'Естественные науки' .— 2016 .— № 3 .— С. 91-96 .— doi: 10.17238/issn2227-6572.2016.3.91 .— URL: https://rucont.ru/efd/512346 (дата обращения: 28.09.2021)

Автор: Корабельщикова

Приведен и доказан ряд свойств глобальных надмоноидов свободных моноидов, которые, в свою очередь, также являются моноидами. В частности, доказаны условия наличия левого и правого делителей в рассматриваемых глобальных надмоноидах, из которых следует несвободность последних. На основании этих свойств доказано необходимое условие выполнения равенства Am = Bn для глобальных надмоноидов свободных моноидов, которое состоит в наличии у глобальных надмоноидов А и В общего корня (в общем случае различной степени). Результаты получены при условии, что по крайней мере один из языков обладает свойством префикса. Также рассмотрена задача нахождения корня n-й степени из заданного языка. Она решается для языка специального вида, состоящего из всех слов длиной от t1 до t2 (t1 ≤ t2) над алфавитом Σ . Очевидно, что критерий существования корня n-й степени – делимость t1 и t2 на n. В работе приведено необходимое и достаточное условие того, что язык специального вида является корнем n-й степени из заданного языка такого же вида, введены понятия тривиального и первообразного корня, представлен пример, поясняющий данные определения. Все приведенные в статье примеры актуальны для прикладных вопросов рассматриваемой теории, в частности для построения специальных вариантов автоматизированного преобразования регулярных грамматических структур и контекстно-свободных грамматик в системах автоматизации построения компиляторов. В терминах введенных нами понятий формулируется необходимое условие того, что язык произвольного вида в алфавите Σ является корнем n-й степени из заданного языка специального вида. Вопрос о том, достаточно ли полученное авторами условие, пока остается открытым.

Этот факт будем обозначать Pr(A).) <...> Если Pr(A) и AB = AC, то В = С. 2. Если Pr(A) и Pr(B), то Pr(AB). 3. Если Pr(AB), то Pr(B). <...> Если Pr(A), Pr(B) и AX = = BY для каких-либо X и Y, то (∃C)(A = BC или B = AC). Доказательство. <...> Согласно свойству 2, из Pr(A) следует Pr(Am), а значит, Pr(Bn) и по свойству 3 верно Pr(B). <...> Поэтому для некоторого r ∈ N либо pr = 0, либо qr = 0.

72

Тимофийчук, А. Изучение регуляторов роста растений нового поколения при выращивании кукурузы на зерно / А. Тимофийчук // Агрохимический вестник .— 2013 .— №2 .— С. 14-15 .— URL: https://rucont.ru/efd/354411 (дата обращения: 28.09.2021)

Автор: Тимофийчук

В статье рассмотрены результаты исследований по изучению влияния регуляторов роста растений нового поколения Вермистим, Вермибиомаг, Вермийодис на продуктивность кукурузы гибридов PR39R58 и Кадр 267 на зерно в условиях западной Лесостепи Украины.

роста растений нового поколения Вермистим, Вермибиомаг, Вермийодис на продуктивность кукурузы гибридов PR39R58 <...> При предпосевной обработке семян кукурузы гибрида PR39R58 регуляторами роста нового поколения густота <...> Величина ассимиляционной поверхности гибрида PR39R58 изменялась как при однократном, так и двукратном <...> Так, у гибрида PR39R58 в фазе молочная спелость при двукратном опрыскивании Вермибиомагом в дозе 8 л/ <...> Влияние регуляторов роста на урожайность зерна кукурузы гибрида PR39R58 при опрыскивании растений во

73

Богоявленский, А.Е. ТЕОРИЯ ПАБЛИК РИЛЕЙШНЗ КАК ФЕНОМЕН НЕКЛАССИЧЕСКОЙ И ПОСТНЕКЛАССИЧЕСКОЙ НАУКИ / А.Е. Богоявленский // Вестник Воронежского государственного университета. Серия: Филология. Журналистика. .— 2014 .— №3 .— С. 104-107 .— URL: https://rucont.ru/efd/507526 (дата обращения: 28.09.2021)

Автор: Богоявленский

статья посвящена представлению паблик рилейшнз в парадигме неклассической и постнеклассической науки

Key words: PR, Public Relations, nonclassical science, postnonclassical science. <...> Важной базовой точкой теории PR может стать положение о генетическом коде паблик рилейшнз. И. <...> Признавая несомненный вклад томского исследователя в теорию PR, уточним, что «структура ДНК» PR может <...> Таким образом, современное толкование сущности PR может быть таково: генеральная цель PR – создание авторитета <...> Центральное звено генетического кода PR / А. Е. Богоявленский // Журналистика в 2012 году.

74

Кудрявцева, М.Е. К ВОПРОСУ О ФУНДАМЕНТАЛЬНЫХ ОСНОВАХ ГУМАНИТАРНОГО ОБРАЗОВАНИЯ / М.Е. Кудрявцева // Вестник Воронежского государственного университета. Серия: Филология. Журналистика. .— 2005 .— №1 .— С. 177-185 .— URL: https://rucont.ru/efd/522657 (дата обращения: 28.09.2021)

Автор: Кудрявцева

Глобальные перемены, происходящие в мире в целом и в России в частности, предъявляют новые, серьезные требования к подготовке специалиста с высшим образованием. Профессионализм в современном мире предполагает не только владение на высоком уровне профессиональными технологиями, но глубокое осознание ответственности за свою деятельность, способность к прогнозированию последствий, которые она может за собой повлечь, предполагает взгляд на человека как цель любой деятельности и меру всех вещей, причастность к ключевым проблемам человечества. В связи с этим актуальным вопросом современного высшего образования становится его гуманитаризация, сущностью которой является воспитание у студента культуры научного и практического мышления

Íà ïîñëåäíåì êóðñå ñòóäåíòû ñëóøàþò èíòåãðàòèâíûé êóðñ “Îðãàíèçàöèÿ è ïðîâåäåíèå PR-êàìïàíèé”, ïèøóò <...> Òàêèì îáðàçîì, öèêë PR-îáðàçîâàíèÿ, êàçàëîñü áû, ïîëó÷àåò ñâîå çàâåðøåíèå. <...> Êðîìå òîãî, áûë ïðîâåäåí áëèö-îïðîñ ñðåäè èíîãîðîäíèõ ñòóäåíòîâ, ïðèåõàâøèõ íà PR-ôåñòèâàëü â ËÝÒÈ. 35 <...> Íà ðàçëè÷íûõ ýòàïàõ äåÿòåëüíîñòè PR-ñïåöèàëèñòà àêöåíò ïàäàåò íà òîò èëè èíîé âèä äåÿòåëüíîñòè. <...> Æóðíàëèñòèêà. 2005, ¹ 1 â ïðàêòèêå PR è â PR-îáðàçîâàíèè ïîäðàçóìåâàþò “îáùåíèå”, äëÿ öåëåé íàøåãî êóðñà

75

ВЛИЯНИЕ АНТИТЕЛ К  ЭСТРАДИОЛУ И  ПРОГЕСТЕРОНУ НА СОДЕРЖАНИЕ ЭТИХ ГОРМОНОВ В  СЫВОРОТКЕ КРОВИ У  ЗДОРОВЫХ ЖЕНЩИН И  БОЛЬНЫХ РАКОМ МОЛОЧНОЙ ЖЕЛЕЗЫ / А.Н. Глушков [и др.] // Российский иммунологический журнал = Russian Journal of Immunology .— 2017 .— №1 .— С. 26-34 .— URL: https://rucont.ru/efd/610432 (дата обращения: 28.09.2021)

Автор: Глушков

Исследовали антитела, специфичные к  бензо[а]пирену, эстрадиолу и  прогестерону (IgA-Bp, IgA-Es и IgA-Pg) у здоровых женщин в постменопаузе и больных раком молочной железы (РМЖ) полуколичественным иммуноферментным методом. Обнаружили прямые линейные взаимосвязи между уровнями IgA-Вp, с одной стороны, и IgA-Es и IgA-Pg, с другой стороны. При совместном образовании IgA-Es и IgA-Pg повышался риск возникновения ER+PR+, но не ER+PR– и ER–PR– РМЖ. Концентрация Es в сыворотке крови больных РМЖ была выше, а Pg ниже, чем у здоровых. Содержание Es и Pg у здоровых женщин было выше в присутствии IgA-Es и IgA-Pg, чем при отсутствии указанных антител. При совместном образовании IgA-Es и  IgA-Pg у  больных ER+PR+ РМЖ содержание Es не изменилось, а Pg было выше, чем при отсутствии этих антител. Таким образом, у здоровых женщин в фазе промоции канцерогенеза IgA-Es и IgA-Pg стимулировали пролиферацию ER+PR+ эпителиальных клеток молочной железы. У больных РМЖ IgA-Es и IgA-Pg тормозили прогрессию опухоли. Предположили, что индукция IgA-Вр может повлечь за собой образование антител к другим эндогенным стероидам и изменения в обмене минералокортикоидов и глюкокортикоидов. Поэтому применение антиканцерогенных вакцин для активной иммунопрофилактики рака у человека может привести к негативным гормональным сдвигам в организме, вплоть до стимуляции сопутствующих заболеваний. Иммуноанализ IgA-Es и IgA-Pg может оказаться полезным для определения риска возникновения ER+ РМЖ и лечения селективными модуляторами ER.

При совместном образовании IgA-Es и IgA-Pg повышался риск возникновения ER+PR+, но не ER+PR– и ER–PR– <...> –), рецептор-положительные (ER+PR+) и смешанные (ER+PR–). <...> – (22,7%) и ER+PR– (21,4%). <...> – и ER+PR+, но не с ER–PR– РМЖ [30]. <...> ) and ER–PR– (22,7%) and ER+PR– (21,4%) BCP (OR = 2,2).

76

Гребенников, В.И. РЕНТГЕНОВСКИЙ КРУГОВОЙ МАГНИТНЫЙ ДИХРОИЗМ ПРИ СИЛЬНЫХ СПИНОВЫХ ФЛУКТУАЦИЯХ / В.И. Гребенников, Т.В. Кузнецова // Известия Российской академии наук. Серия физическая .— 2017 .— №3 .— С. 74-77 .— URL: https://rucont.ru/efd/592603 (дата обращения: 28.09.2021)

Автор: Гребенников

Обсуждается проблема определения величины атомных магнитных моментов в соединениях с редкоземельными и переходными элементами по спектрам рентгеновского магнитного кругового дихроизма (XMCD). Стандартный подход правил сумм часто дает величину моментов, в разы меньшую их значений, получаемых из магнитных измерений. Мы связываем это с сильными спиновыми флуктуациями в поверхностном слое, в котором формируется XMCD-сигнал. Предложен и реализован способ определения величины локальных магнитных моментов в присутствии сильных флуктуаций

в манганите La0.5Pr0.2Ca0.3MnO3 [4]. <...> На рис. 3 показаны XANESи XMCD-спектры Pr M4, 5 краев, происходящие от переходов электронов из Pr 3d <...> То же, что на рис. 1 на Pr М4, 5-краях поглощения. <...> Их величина 3.81 μB/Pr, причем орбитальный вклад основной. <...> Pr магнитные моменты, μB/Pr Магнитный момент Вверх Вниз Поверхность Объем Спиновый –0.84 0.07 –0.77 –

77

Тараненко, Т.С. ФОРМИРОВАНИЕ ИМИДЖА БИБЛИОТЕКИ СРЕДСТВАМИ PR-ТЕХНОЛОГИЙ И РЕКЛАМЫ НА ПРИМЕРЕ МАУК «МУНИЦИПАЛЬНАЯ ИНФОРМАЦИОННО-БИБЛИОТЕЧНАЯ СИСТЕМА» г. КЕМЕРОВО / Т.С. Тараненко // Молодые в библиотечном деле .— 2015 .— №2 .— С. 31-39 .— URL: https://rucont.ru/efd/388600 (дата обращения: 28.09.2021)

Автор: Тараненко Татьяна Сергеевна

Сегодня само существование и развитие библиотек напрямую зависит от общественного мнения. Новая ситуация диктует поиск новых форм работы, и маркетинговые коммуникации библиотеки являются сегодня не просто обязательными, но в нынешних условиях принципиально важными составляющими успеха библиотеки. По одному из определений «Маркетинг — двигатель, который приводит в движение все другие виды деятельности». Инструментов повышения востребованности библиотек, их ресурсов и услуг немало, но я расскажу лишь о некоторых наиболее удачных направлениях.

, Интернет — PR, PR на телевидении, радио PR и др. <...> В своей PR деятельности МИБС Кемерово использует ряд PR-мероприятий. <...> Проблема оценки эффективности PR-кампаний и PR-акций всегда была очень дискуссионной. <...> показатели результативности PR: 1. <...> PR для заказчика: Принципы работы с PR-специалистом [Электронный ресурс]/ Д. И.

78

№1 [Вестник Южно-Уральского государственного университета. Серия "Математическое моделирование и программирование", 2015]

Публикуются статьи, обзоры и краткие сообщения ученых ЮУрГУ, вузов и научно-исследовательских организаций России, посвященные актуальным вопросам математического моделирования и программирования.

have pr1(z) ∈ A and pr2(z) ∈ B. <...> in particular, pr1(z) 6= pr2(z) ∀z ∈ K. <...> To this end, note that, according to (3.68), c ( pr2(ĥ1), pr1(ĥ2), {β̂(s) : s ∈ 2, n} ) = c ( pr2(z <...> ), pr1(h1), {β̂(s) : s ∈ 2, n} ) . (3.77) However, (3.65) implies that pr2(z) = pr2(h0). <...> Then, (3.77) yields the equality c ( pr2(ĥ1), pr1(ĥ2), {β̂(s) : s ∈ 2, n} ) = c ( pr2(h0), pr1(h1),

Предпросмотр: Вестник Южно-Уральского государственного университета. Серия Математическое моделирование и программирование №1 2015.pdf (0,3 Мб)
79

Кононенко, Г.П. О КОНТАМИНАЦИИ МИКОТОКСИНАМИ СЕНАЖА И СИЛОСА В ЖИВОТНОВОДЧЕСКИХ ХОЗЯЙСТВАХ / Г.П. Кононенко, А.А. Буркин // Сельскохозяйственная биология .— 2014 .— №6 .— С. 117-123 .— URL: https://rucont.ru/efd/410364 (дата обращения: 28.09.2021)

Автор: Кононенко

Совершенствование приемов оценки санитарного качества травяных кормов с учетом всего многообразия факторов негативного воздействия на животных — важнейшая задача сельскохозяйственной науки. В представленной работе изучена загрязненность сенажированных и силосованных кормов микотоксинами (Т-2 токсин, диацетоксисцирпенол, дезоксиниваленол, зеараленон, фумонизины, альтернариол, стеригматоцистин, эмодин, циклопиазоновая кислота, охратоксин А, цитринин, микофеноловая кислота, PR-токсин, афлатоксин В1 и эргоалкалоиды) с помощью метода непрямого конкурентного иммуноферментного анализа. В результате обследования 30 производственных партий с предприятий, расположенных в центральных областях (Брянская, Липецкая, Московская, Смоленская и Тверская) европейской части России, установлен множественный характер загрязненности. Во всех образцах было найдено 8 и более микотоксинов и более чем в половине — 14-15. Альтернариол встречался повсеместно в обоих видах кормов в количествах 50-1260 мкг/кг, для афлатоксина В1, охратоксина А, цитринина и эргоалкалоидов отмечали обширную контаминацию малой интенсивности. В сенаже при высокой встречаемости всех фузариотоксинов массовая концентрация Т-2 токсина была наименьшей (4-30 мкг/кг), а количества диацетоксисцирпенола, дезоксиниваленола, зеараленона и фумонизинов соответствовали диапазону 100-1000 мкг/кг. Стеригматоцистин, эмодин, циклопиазоновая и микофеноловая кислоты, PR-токсин имели практически повсеместное распространение, при этом эмодин, циклопиазоновая кислота и PR-токсин — нередко в количествах свыше 1000 мкг/кг. В силосе, заготовленном в основном из травостоя кукурузы, отмечены черты сходства с зерном этой культуры из центра европейской России по частому обнаружению Т-2 токсина и дезоксиниваленола в значительных количествах (соответственно до 350 и 2820 мкг/кг). Стеригматоцистин и эмодин присутствовали во всех образцах, PR-токсин, циклопиазоновая кислота и микофеноловая кислота несколько уступали по этому показателю. Их накопление было ниже, чем в сенаже, а для микофеноловой кислоты в целом оставалось прежним. Среди возможных причин различий в контаминации сенажа и силоса обсуждаются ботанический состав травостоев и особенности комплекса токсинообразующих грибов, сопровождающих вегетацию растений и последующий процесс ферментирования.

(PR) îñóùåñòâëÿëè ñîãëàñíî ìåòîäèêå, îïèñàííîé â ïðåäûäóùåé ðàáîòå (12). <...> — PR-òîêñèí, ÀÂ1 — àôëàòîêñèí Â1, ÝÀ — ýðãîàëêàëîèäû. <...> ÑÒÅ, ÖÏÊ, ÌÔÊ, PR èìåëè ïðàêòè÷åñêè ïîâñåìåñòíóþ ðàñïðîñòðàíåííîñòü, ïðè ýòîì ñîäåðæàíèå ÖÏÊ è PR íåðåäêî <...> Îäíàêî òàêîãî âûñîêîãî ñîäåðæàíèÿ ÑÒÅ, ÝÌÎ, PR, êàê â ñåíàæå, âûÿâëåíî íå áûëî. <...> emodin, cyclopiazonic acid and PR-toxin often present in amounts up to 1000 µg/kg.

80

Мирошниченко, Т.П. ДИНАМИКА ГОРЕНИЯ ГАЗА В КАНАЛЕ С ИСТЕЧЕНИЕМ ПРОДУКТОВ СГОРАНИЯ ЧЕРЕЗ ПОРИСТУЮ СТЕНКУ / Т.П. Мирошниченко, Н.С. Беляков, С.С. Минаев // Физика горения и взрыва .— 2015 .— №3 .— С. 13-19 .— URL: https://rucont.ru/efd/356333 (дата обращения: 28.09.2021)

Автор: Мирошниченко

Рассматривается процесс истечения газа из сосуда с пористыми проницаемыми стенками, в котором происходит горение. Горение газа в резервуаре вызывает повышение давления в нем и фильтрационное течение газа через проницаемую пористую стенку в окружающее пространство. Предложена модель, которая одновременно описывает нарастание давления в сосуде за счет горения и связанное с этим процессом фильтрационное течение газа через пористые стенки. На основе численного решения одномерной задачи получены данные о максимальном давлении газа в резервуаре, времени разгрузки и характеристиках потока в зависимости от проницаемости среды.

p0 )1/γ , Tr1 = pr Rρr1 . <...> − 1 γpr dpr dt (x+H0) ∂ρr2 ∂x = 0. (7) Общее решение уравнения (7) принимает вид ρr2 = Φ [ (x+H0) ( pr <...> p0 )1/γ](pr p0 )1/γ , (8) где функцию Φ можно найти из условия изменения плотности газа на движущемся <...> (tn) pr(τ) )1/γ − 1 ] + + xf (tn) ( pr(tn) pr(τ) )1/γ . (10) Учитывая (8)–(10), находим распределение <...> При x = 0 имеем υr2 = υout , и тогда падение давления в резервуаре описывается уравнением 1 pr dpr dt

81

СИСТЕМА УПРАВЛЕНИЯ ОТКЛЮЧАЕМЫМИ АНОДНЫМИ СЕКЦИЯМИ ПРИ РЕВЕРСИРОВАНИИ ТОКА В ГАЛЬВАНИЧЕСКИХ ПРОЦЕССАХ / В.В. Конкина [и др.] // Автоматизация, телемеханизация и связь в нефтяной промышленности .— 2017 .— №1 .— С. 38-44 .— URL: https://rucont.ru/efd/569412 (дата обращения: 28.09.2021)

Автор: Конкина

Неравномерное распределение толщины гальванического слоя по поверхности детали снижает коррозионную стойкость покрытия. Существующие подходы, реализующие сочетание оптимальных режимов электролиза с геометрическими условиями нанесения покрытия, сложны в технической реализации и при этом не всегда приносят ожидаемые результаты (в плане равномерности), имеют существенные недостатки (дороговизна, конструктивная сложность и снижение производительности гальванической линии в целом), что не способствует их широкому распространению при производстве изделий для нефтегазового оборудования. В связи с этим предложен оригинальный способ снижения неравномерности гальванического покрытия с использованием системы независимых анодных секций, отключаемых в процессе нанесения покрытия в режиме реверсирования тока. Для описанного процесса формулируется задача поиска оптимального управления в соответствии с критерием неравномерности распределения слоя покрытия и приведено описание основных методов и алгоритмов решения. Разработана трехуровневая структура системы управления. На конкретном примере нанесения никелевого покрытия на изделие экспериментально демонстрируется эффективность предлагаемого гальванического процесса по сравнению с существующими технологическими решениями

NaS  для "прямого"   * τprM NI  и "обратного"  * τobM NI  тока с длительностями включения *τ pr <...> ob zadj j j T     (2)   υ max 1 τ τ ,pr obj j j T T     (3) где δzad, δmax, δmin – заданная <...>                1,1 1, 1, ,1 , , ,1 , , τ ... τ ... τ τ τ ... τ ... τ , τ ... τ ... τ pr <...> pr pr n N pr pr pr pr M N m m n m N pr pr pr M M n M N I I I I I I I I I I             <...> j pr m n pr j m n I m n          , 0, если , -я секция в момент времени τ τ отключена от

82

Кодексы профессионального поведения в сфере связей с общественностью статья

Автор: Российская Ассоциация по связям с общественностью
Институт муниципального управления

Публикуются Кодекс профессионального поведения Международной Ассоциации по связям с общественностью (IPRA), Европейский кодекс профессионального поведения (СЕRР) и Российский Кодекс профессиональных и этических принципов (РАСО).

КРИТЕРИИ И НОРМЫ ПРОФЕССИОНАЛЬНОЙ КВАЛИФИКАЦИИ ПРАКТИЧЕСКИХ РАБОТНИКОВ PR, НАЛАГАЕМЫЕ НА НИХ НАСТОЯЩИМ <...> Статья 5 2 Принят Генеральной ассамблеей Европейской конфедерации PR (СЕRР) в Лиссабоне в апреле 1978 <...> Статья 7 В своей деятельности практический работник PR должен соблюдать полную конфиденциальность. <...> Статья 8 Практический работник PR, имеющий какие-либо права или интересы, которые могут противостоять <...> По отношению к коллегам – работникам PR Статья 17 Работник PR должен воздерживаться от нечестной конкуренции

Предпросмотр: Кодексы профессионального поведения в сфере связей с общественностью.pdf (0,1 Мб)
83

Программа прохождения производственной и преддипломной практик специальности 030602.65 «Связи с общественностью»

Изд-во ПГУТИ

Методические указания направлены на оказание помощи студентам прохождении производственной и преддипломной практик, подготовке оформлении отчетов по всем видам практик специальности «Связи с общественностью».

План-сценарий одной PR-акции. 6. <...> Цель практики: знакомство PR-специалиста с механизмами взаимодействия PR-отделов и СМИ. <...> План-сценарий одной PR-акции, 5. <...> Плановое участие в работе PR-отделов и отделов по работе с СМИ. <...> построения и оценки PR-деятельности. 5.

Предпросмотр: Программа прохождения производственной и преддипломной практик специальности 030602.65 «Связи с общественностью» .pdf (0,2 Мб)
84

Зубюк, А.В. Теоретико-возможностная модель в задачах морфологического анализа изображений / А.В. Зубюк // Вестник Московского университета. Серия 3. Физика. Астрономия .— 2011 .— №6 .— С. 49-56 .— URL: https://rucont.ru/efd/572515 (дата обращения: 28.09.2021)

Автор: Зубюк

Рассмотрены теоретико-возможностные модели в математических методах морфологического анализа изображений, в частности, получено решение задачи классификации изображений сцен в теоретико-возможностной постановке, которое может быть использовано для анализа формы акустических сигналов в геофизике [1], для решения задач интерпретации спутниковых изображений [2] и др. Разработаны методы эмпирического построения нечеткой формы

Ïëîòíîñòü ðàñïðåäåëåíèÿâåðîÿòíîñòè Pr îáîçíà÷èì pr(�) : Y ! [0,1) . <...> ,K , òàêèìè,÷òîáû âûïîëíÿëèñü óñëîâèÿ8 y 2 Yk, y0 2 Yk+1, pr(y)> pr(y0), k= 1, . . . <...> ,K�1, áûëè âåðíû ñëåäóþùèåñîîòíîøåíèÿ:k�1Xk0=1Pr(Yk0) + 2Pr(Yk)> 1+ ak, k= 1, . . . ,K�1. (9)4.1. <...> )� (Y,A,Pr)� . . . . <...> Ïëîòíîñòü ðàñ-ïðåäåëåíèÿ âåðîÿòíîñòè Pr , ðàâíàÿ pr1(x1)pr2(x2) ,x1, x2 2 (�1,1) , ïðåäñòàâëåíà íà ðèñóíêå

85

№1 [Право и жизнь, 2010]

На страницах журнала публикуются различные материалы, отражающие состояние нашей российской правовой системы, развитие законодательства, его строительства и применения на практике.

�� &�����������&���������[�����&�� ����9� 4�PR�)�6�4 6�>�5�6�P�6� A��6 5�PR�)�6�5��56�>�5A6�P�6�55@ 6 <...> �8#�FF�PR�)�6�5��@6�>�A? <...> B�@ 6 4�PR�)�6�4 A6�>� 56�P�6� � 6 5�PR�)�6�4 A6�>� A6�P�6� @A�6 �PR�)�6�4 @6�>��46�P�6� 6 A�PR�)�6�4 <...> �� 4�PR�)�6�4 ? <...> 6�>�5�6�P�6� � 56 5�PR�)�6�5��56�>�@5�7��&����86�P�6�@4A�6 �PR�)�6�5���6�>�56�P�6�4@�6 A�PR�)�6�4 6�>

Предпросмотр: Право и жизнь №1 2010.pdf (0,2 Мб)
86

The English Word практикум

Автор: Осиянова
ОГУ

В практикуме рассмотрены такие вопросы лексикологии, как структура слова, этимология словарного состава английского языка, словообразование и словосложение, семасиология, омонимия, синонимия и антонимия современного английского языка, фразеологические единицы и словосочетания, основы английской лексикографии и др. Практический материал, предназначенный для самостоятельной работы и работы на семинарах, тесно увязан с теоретическим материалом лекций. Приложение содержит справочный материал, необходимый для выполнения упражнений.

'on-' awaken, ashamed benon-pr. OE. be. In Mn. <...> Prefixes of Greek Origin Таблица F. 4 anon-pr. <...> -pr. songster spinster In Mn. E. <...> Non-pr. twofold, threefold, fourfold, manifold -ful OE -ful Denotes 'full of, 'abounding’ pr. thankful <...> -long non-pr. headlong, sidelong -wise OE.

Предпросмотр: The English Word.pdf (0,4 Мб)
87

Самукта, Н. ВЛИЯНИЕ ХИМИЧЕСКИХ РЕАКЦИЙ НА ХАРАКТЕРИСТИКИ СМЕШАННО-КОНВЕКЦИОННОГО ПОТОКА ЖИДКОСТИ ВБЛИЗИ ВЕРТИКАЛЬНО РАСТЯГИВАЕМОЙ ПЛАСТИНЫ ПРИ НАЛИЧИИ НЕОДНОРОДНОГО МАССООБМЕНА / Н. Самукта, Р. Равиндран, М. Ганапатирао // Прикладная механика и техническая физика .— 2017 .— №1 .— С. 133-146 .— URL: https://rucont.ru/efd/579970 (дата обращения: 28.09.2021)

Автор: Самукта

Проведено исследование влияния химической реакции, выделения и поглощения тепла на характеристики стационарного смешанно-конвекционного потока в пограничном слое на вертикально растягиваемой пластине при наличии неравномерного вдува (отсоса) через щелевое отверстие. С помощью группы неавтомодельных преобразований исходные уравнения для пограничного слоя с граничными условиями преобразованы к безразмерному виду. В результате численного решения системы нелинейных дифференциальных уравнений с частными производными получены неавтомодельные решения. Проведены расчеты скорости, температуры и концентрации, локального коэффициента трения поверхности, локального числа Нуссельта и числа Шервуда при различных значениях безразмерных параметров. Показано, что при неравномерном отсосе через щелевое отверстие локальные числа Нуссельта и Шервуда увеличиваются, а при неравномерном вдуве через щелевое отверстие — уменьшаются. Установлено, что при выделении тепла локальное число Нуссельта уменьшается, в то время как при его поглощении — увеличивается

1) u ∂u ∂x + v ∂u ∂y = Ue ∂Ue ∂x + ν ∂2u ∂y2 + g [ β(T − T∞) + β∗(C − C∞) ] , u ∂T ∂x + v ∂T ∂y = ν Pr <...> m+ 1 2 fGη − nPrFG+ Pr ξ2SG = Pr m+ 1 2 ξ(FGξ −Gηfξ); (4) Hηη + Sc m+ 1 2 fHη − n ScFH − Sc ξ2∆H = Sc <...> (m+ 1 2 f + m+ 1 2 ξfξ ) , Y i2 = Pr(Sξ 2 − nF ), Y i3 = −Pr (m+ 1 2 ξGξ + nG ) , Y i4 = −Pr m+ 1 2 <...> Влияние параметра плавучести λ и числа Прандтля Pr на скорость F и температуруG показано на рис. 3. <...> : сплошные линии — Pr = 0,7, штриховые — Pr = 7,0; 1 — λ = −0,5, 2 — λ = −0,3, 3 — λ = −0,1, 4 — λ =

88

Лобанов, И.Е. МАТЕМАТИЧЕСКОЕ МОДЕЛИРОВАНИЕ ИНТЕНСИФИЦИРОВАННОГО ТЕПЛООБМЕНА ПЕРМАНЕНТНО ЗАКРУЧЕННОГО ВНУТРИ КРУГЛОЙ ТРУБЫ ПОТОКА / И.Е. Лобанов // Фундаментальные и прикладные проблемы техники и технологии .— 2014 .— №4 .— С. 36-45 .— URL: https://rucont.ru/efd/483998 (дата обращения: 28.09.2021)

Автор: Лобанов

В результате исследования были получены решения для интенсифицированного теплообмена при турбулентном течении теплоносителей в вышеуказанных каналах, более общие, чем существующие. Полученные в данном исследовании решения верифицированы существующим и оригинальным экспериментальным материалом. Существующие решения являются частным случаем новых решений.

dT (20)              5 0 5 04 3 1 30 5 , Pr5Pr5 Pr5 1 Pr ddT (21) где =0,032 и 51 <...> Pr5Pr5 Pr5 1 Pr dddddddT                                     <...> 3 1 3 14 3 1      .Pr10Pr452Pr4Pr70Pr51ln Pr 1 4 125 Prβ η251arctg Prβ η251arctg 224 3 14 3 <...> в данной работе теорию, получим при Re=4·104: 22,1NuNu 1000Pr 50 2140Pr     CT  . <...>     CT  ; 02,2NuNu 1000Pr 20 15800Pr     CT  ; 53,2NuNu 1000Pr 10 39000Pr     CT  .

89

Палымский, И.Б. КОНВЕКЦИЯ РЭЛЕЯ — БЕНАРА В ХИМИЧЕСКИ АКТИВНОМ ГАЗЕ, НАХОДЯЩЕМСЯ В СОСТОЯНИИ ХИМИЧЕСКОГО РАВНОВЕСИЯ / И.Б. Палымский, В.И. Палымский, П.А. Фомин // Физика горения и взрыва .— 2017 .— №3 .— С. 3-14 .— URL: https://rucont.ru/efd/614294 (дата обращения: 28.09.2021)

Автор: Палымский

В приближении Буссинеска численно исследуется конвекция Рэлея — Бенара в химически активном газе, находящемся в состоянии химического равновесия. Рассматривается плоский слой с изотермическими и свободными от касательных напряжений горизонтальными границами. Термодинамические параметры газа (водородокислородная смесь) рассчитываются по предложенной ранее модели химического равновесия. Показано, что учет процессов рекомбинации и диссоциации приводит к появлению дополнительного множителя при числе Рэлея. Получено выражение для инкремента нарастания бесконечно малых возмущений и соотношение для критического числа Рэлея как функции температуры. Установлено, что нейтральные кривые состоят из верхней (неустойчивость при подогреве снизу) и нижней (неустойчивость при подогреве сверху) ветвей. Приведены результаты расчетов нелинейного стационарного режима

(ψyωx − ψxωy) = Δω +CRaQx, Δψ = −ω, (5) Qt + 1 Pr (ψyQx − ψxQy) = 1 Pr ΔQ− 1 Pr ψx, C = 1 β d dT (βT <...> Pr ψx. <...> Подставляя (7) в (6), после стандартных вычислений [1, 2] находим λ1,2 = 1 + Pr 2Pr S ± √( 1− Pr 2Pr <...> ΔQ− 1 Pr ψx. <...> (ψyωx − ψxωy) = 1 2 Δω, (11) Qt + 1 Pr (ψyQx − ψxQy) = 1 2Pr ΔQ.

90

Смирнягин, С.В. ИНЖЕНЕРЫ ЧЕЛОВЕЧЕСКИХ ЖЕЛАНИЙ / С.В. Смирнягин // Обсерватория культуры .— 2013 .— №4 .— С. 60-67 .— URL: https://rucont.ru/efd/447407 (дата обращения: 28.09.2021)

Автор: Смирнягин

Рассматривается процесс вхождения в социокультурное пространство современной России понятия «копирайт», его актуальность для различных организаций и учреждений. Особое внимание уделено основным принципам написания текстов для рекламы

Применительно к сфере PR (общественные связи, от англ. — Public Relations) текстам копирайтеров отводится <...> Отличие PR-текста от рекламного состоит в том, что он не всегда впрямую является восхвалением, часто <...> являет собой образчик беседы знатока риторики (имиджмейкера, как часто называют специалистов в сфере PR <...> в офисах гигантских предприятий, общественных организаций и агентствах, специализирующихся в сфере PR <...> В целях достижения пропагандистских интересов PR-менов (точнее, стоящего за их спиной истеблишмента,

91

ЦВЕТОВОДСТВО И СЕЛЕКЦИЯ ПЕРВОЦВЕТА АВТОРЕФЕРАТ ДИС. ... КАНДИДАТА СЕЛЬСКОХОЗЯЙСТВЕННЫХ НАУК

Автор: СКЕЙВЕНЕ
ЛИТОВСКАЯ СЕЛЬСКОХОЗЯЙСТВЕННАЯ АКАДЕМИЯ

ЦВЕТОВОДСТВО И СЕЛЕКЦИЯ ПЕРВОЦВЕТА

., Pr. beesiana Forr., Pr. denticulata Smith., Pr., japonica Grau, Pr. rosea Royle, Pr. <...> . obconica Hance, Pr. chinensis Lindl., Pr. <...> Pr. malacoides фиолетовая х Pr. obconica яркокрасная; 3. <...> Pr. malacoides фиолетовая x Pr. obconica светлоеипяя; 5. <...> Pr. malacoides белая x Pr. malacoides пурпурпокрасная.

Предпросмотр: ЦВЕТОВОДСТВО И СЕЛЕКЦИЯ ПЕРВОЦВЕТА.pdf (0,0 Мб)
92

Теплообмен и гидравлическое сопротивление в трубах и каналах учеб. пособие для вузов по направлению «Теплоэнергетика и теплотехника»

Автор: Деменок С. Л.
СПб.: Страта

В учебном пособии рассмотрены вопросы, связанные с выводом основных соотношений, определяющих численные значения характеристик гидродинамики и теплообмена в трубах и каналах. Особое внимание уделено вопросам теоретического рассмотрения характеристик потока вблизи ограничивающих его стенок. Приведены представительные данные по исследованию теплообмена и трения при турбулентном течении в трубах и каналах.

1 ξ −+ − ( )8 55 Pr 1 1 Pr 1 6 l ξ ξ   − + + −     ( )0,770,125 8 ln Pr9,46 Pr 1 2,46 1 <...> 1 Pr 12,3n Pr 2 13,88arctg 0,866 Pr 1 705Pr 1 Pr 1Pr 1  + = + + − −  + −−   ( )r 1 8 ξ − + Copyright <...> 2,4 Pr (Pr) 760 1 0,2 Pr ξ ξ ϕ   + + ⋅  +  ÷ 1 , φ(1)=0,815 ( ) ( ) 0,0350,8 0,973 5 0,814(Pr) <...> Pr 0,0189 Pr 8 10 Re −−+ − ⋅ 1/3 8 Pr 11,8 8 Pr ξ ξ −      ( )0,125 0,167 8 Re Pr Pr 1 ξ − −+ − <...> 8 r ln(1 5Pr) 0,5ln(Re 8 / 60) ξ ξ + + +  0,22 8 ,8(Pr 1,3) Pr 8 ξ ξ− + −  2/3 1 1 2RePr[ (Pr

Предпросмотр: Теплообмен и гидравлическое сопротивление в трубах и каналах.pdf (0,4 Мб)
93

МЕГАБЛОК САРМАТИЯ КАК ОСКОЛОК СУПЕРКРАТОНА ВААЛБАРА: КОРРЕЛЯЦИЯ ГЕОЛОГИЧЕСКИХ СОБЫТИЙ НА ГРАНИЦЕ АРХЕЯ И ПАЛЕОПРОТЕРОЗОЯ / К.А. Савко [и др.] // Стратиграфия. Геологическая корреляция .— 2017 .— №2 .— С. 7-30 .— URL: https://rucont.ru/efd/592090 (дата обращения: 28.09.2021)

Автор: Савко

Результаты корреляции геологических событий в интервале 2.8–2.0 млрд лет предполагают принадлежность к древнему суперкратону Ваалбара, состоящему из кратонов Пилбара и Каапвааль, еще одного литосферного сегмента – мегаблока Сарматия, который выделяется в южной части Восточно-Европейского кратона. В интервале 2.80–2.60 млрд лет все они представляли собой фрагменты континентальной коры, консолидированной около 2.8 млрд лет назад и претерпевшей континентальный рифтогенез, сопровождавшийся мощным базитовым вулканизмом. В интервале 2.60– 2.45 млрд лет для всех трех кратонов была сходная тектоническая обстановка и происходило накопление железисто-кремнистых формаций. Именно железисто-кремнистые формации крупнейших железорудных бассейнов Трансвааль, Хамерсли, Курского и Кременчугско-Криворожского, сформировавшиеся в едином океаническом бассейне в интервале около 2.50–2.45 млрд лет, лежат в основе успешных палеотектонических реконструкций суперконтинента Ваалбара. В интервале 2.45– 2.20 млрд лет на всех трех кратонах отмечается длительный перерыв в осадконакоплении. В конце этого интервала произошла активизация процессов континентального рифтогенеза с терригенным осадконакоплением, завершившимся базитовым вулканизмом около 2.2 млрд лет назад. После этого рубежа начался распад Ваалбары, который был сложным многоактным процессом: составлявшие суперконтинент части то расходились, то снова сближались, пока кратоны Каапвааль и Зимбабве, Пилбара и Йилгарн, Сарматия и Волго-Уралия, соответственно, окончательно не объединились.

) Кременчугская структура (PR1) AR AR AR Волго-Донской ороген AR PR1 PR1 PR1 PR1 PR1 PR1 PR1 PR1 PR1 <...> PR1st + kr PR1tm1 PR1tm1 PR1tm2 PR1tm2PR1tm1 AR1+2 PR1rg PR1rg PR1rg 3 4 5 61 7 8 0 10 20 30 км 2045 <...> ); 4 – стойленская свита (PR1st); 5 – коробковская свита (PR1kr); 6 – роговская свита (PR1rg); 7 – курбакинская <...> PR1st PR1st PR1st PR1st PR1st PR1kr PR1kr PR1kr PR1kr PR1rg νPR1z νPR1z γδPR1sn γPR1at γPR1at γδPR1sn <...> PR1rg PR1kb PR1kb PR1ig 2047 2059 112047 rg st ig mh 12 13 14 15 16 17 kb 18 19 kr3 kr4 kr1 kr2 Copyright

94

Пентковская, Т. Передача конструкций с субстантивированным инфинитивом в древнейшем славянском переводе Жития Василия Нового / Т. Пентковская // Вестник Московского университета. Серия 9. Филология .— 2012 .— №3 .— С. 52-77 .— URL: https://rucont.ru/efd/337863 (дата обращения: 28.09.2021)

Автор: Пентковская
М.: ПРОМЕДИА

Рассматриваются способы передачи греческого субстантивированного инфинитива в древнейшем славянском переводе Жития Василия Нового, выполненном в Древней Руси в конце 11 века. Данные этого памятника сопоставляются с данными других церковнославянских переводов домонгольского периода. Переводчик Жития в определенной мере ориентировался на синтаксические нормы, представленные в ранних редакциях Нового Завета. Часть переводческих решений совпадает с вариантами Толкового Евангелия и Синаксаря, отличаясь в то же время от вариантов близкого по жанру древнерусского перевода Жития Андрея Юродивого.

Рассмотрим сначала конструкции, имеющие значение времени. pr9o to6u + инф. <...> to6u _anacwr)hsas)i me to6u +os)iou kayezom)enou mou pr9oq a_ut(on 7hk)e tiq presb)uteroq pr9oq aut9on <...> . — там находятся такие обороты, как прежде въхождени — pr9o to6u e„sšrcesyai, прежде оувѣдѣни — pr9o <...> to6u peisy6ηnai, прежде быти — pr9o to6u gennhy6ηnai [СДРЯ XI–XIV, VIII: 129]. <...> Следующая серия конструкций имеет значение цели. pr9oq t9o + инф.

95

Белявцева, Е.Е. ПОВЕДЕНИЕ РЕДКОЗЕМЕЛЬНЫХ ЭЛЕМЕНТОВ КАК ОДИН ИЗ ИНДИКАТОРОВ СТРОЕНИЯ КОРЫ ВЫВЕТРИВАНИЯ И СОСТАВА БОКСИТОВ (НА ПРИМЕРЕ ВИСЛОВСКОГО МЕСТОРОЖДЕНИЯ КМА) / Е.Е. Белявцева, В.И. Сиротин // Вестник Воронежского государственного университета. Серия: Геология .— 2009 .— №1 .— С. 38-48 .— URL: https://rucont.ru/efd/515451 (дата обращения: 28.09.2021)

Автор: Белявцева

В статье рассматривается поведение редкоземельных элементов в профиле глиноземной коры выветривания и в наиболее распространенных минералогических типах бокситов. Предварительный анализ позволяет сделать заключение: содержания REE подтверждают зональность коры выветривания и избирательно ведут себя в наиболее распространенных минералого-литологических типах бокситов

Для редкоземельных элементов применяется разделение на легкие (La–Pr), средние (Nd–Dy) и тяжелые (Ho–Lu <...> 1,00 10,00 12 63 /14 /1 12 63 /14 /2 12 63 /15 12 63 /16 12 63 /17 12 63 /19 /1 12 63 /19 /2 La Ce Pr <...> 63 /14 /2 12 63 /15 12 63 /16 12 63 /17 12 63 /19 /1 12 63 /19 /2 Ho Er Tm Yb Lu Y г) 0,10 1,00 La Pr <...> /48 е) 0,10 1,00 10,00 La Pr Sm Gd D y Er Yb Y 1577/21 1577/22 1577/23 ж) 0,01 0,10 1,00 10,00 La Pr <...> Gd D y Er Yb Y 1579/6 1579/9/1 1579/9/2 1579/14 1579/15/1 1579/15/2 1579/16 1579/17 з) 0,1 1 10 La Pr

96

Спорт в системе социальных коммуникаций материалы Всероссийской научно- практической междисциплинарной конференции

М.: РГУФКСМиТ

В сборнике представлены материалы докладов участников Всероссийской научно-практической междисциплинарной конференции по следующим проблемам: спорт как объект современной коммуникативистики: теоретические, методологические, прикладные аспекты, специфика коммуникаций в сфере спорта, их структура и содержание, коммуникативные практики в области физической культуры, знаково-символические особенности спортивной деятельности: спорт и средства массовой информации, спорт, физическая культура и межкультурные коммуникации: представление проблем современной коммуникативистики в процессе подготовки специалистов на основе стандартов 3-его поколения, коммуникации в области физической культуры и спорта как предмет изучения в системе профессионального образования. Материалы представлены в редакции авторов.

Наряду с западным PR, студенты знакомятся со спецификой восточного PR, так как в последнее время страны <...> Второй подход к исследованию истории PR был предложен Д. <...> Каковы особенности американской «исторической школы» PR? <...> Л'Этанг по истории британских PR в XX в. <...> Кривоносова о PR-тексте, где рассматривается также эволюция этого инструмента PR и представлений о нем

Предпросмотр: Спорт в системе социальных коммуникаций.pdf (0,5 Мб)
97

Биотехнологические свойства белков молока [монография]

Автор: Гунькова П. И.
СПб.: ГИОРД

В монографии рассмотрены свойства, структура и номенклатура белков молока, представлены биологическая ценность, биотехнологические свойства данных белков, их влияние на выход и качество молочных продуктов, подробно описаны роль белков в построении оболочек жировых шариков, свойства пептидов и плазмина, показана биотрансформация белков при хранении и обработке молока, предложены методы контроля некоторых свойств белков молока.

., 2 00 4) 1 10 20 H – Ar g – Pr o – Ly s – H is – Pr o – Ile – Ly s – H is – Gl n – Gl y – Le u – Pr <...> y – Pr o – Ile – Pr o – As n – Se r – Le u – Pr o – Gl n – As n – Ile – Pr o – Pr o – Le u – Th r – <...> Gl n – Th r – 81 90 10 0 – Pr o – Va l – Va l – Va l – Pr o – Pr o – Ph e – Le u – Gl n – Pr o – Gl u <...> o – Ly s – Hi s – Ly s – Gl u – M et – Pr o – Ph e – Pr o – Ly s – Ty r – Pr o – Va l – Gl u – Pr o <...> s – Gl n – Pr o – Le u – Pr o – Pr o – Th r – Va l – M et – Ph e – Pr o – Pr o – Gl n – 16 1 17 0 18

Предпросмотр: Биотехнологические свойства белков молока.pdf (0,2 Мб)
98

Aegyptiaca Rossica Выпуск 4

М.: Русский фонд содействия образованию и науке

В сборнике статей, основанном на докладах, прочитанных на круглом столе "Язык(и) древнеегипетской культуры: чтение, понимание, перевод" (2015 г.) представлены работы, относящиеся к различным периодам истории Древнего Египта. Они затрагивают различную проблематику древнеегипетских дисциплин - истории, филологии, религиоведения, культурологии, искусствознания. Статьи посвящены специфике воплощения и диалогу вербальных и невербальных языков древнеегипетской культуры.

m Hzp wp-wAwt pr m izrt Dd-mdw n Ppi-Nfr-kA-ra tp-awy Ppi-Nfr-kA-ra swt sdA pr m Hzp Copyright ОАО « <...> (j)m(j)-r(A) pr, m rA-pr.f jr(j) Hzz.t RA-pr → rA-pr rA-pr von Bissing F. <...> Harpur Y., Scremin P. rA-pr rA-prj.t Vergote J. rA-pr . Steindorff G. Épron L., Daumas F., Goyon G. <...> J., el-Khouli A. 17516 rA-pr rA pr → MHn *Aw.tj Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис <...> sxA s r=f m Pr-nsr Xnt.t psD.t nTr.w grH pfy n ip rnp.wt n Tn.wt Abd.w m pr Iqd iw di=i pwy xms=i m

Предпросмотр: Aegyptiaca Rossica.pdf (1,6 Мб)
99

Карань, Л.С. Сравнительный анализ эффективности выявления ДНК риккетсий группы клещевых пятнистых лихорадок в разных видах клинического материала и возможность видовой идентификации возбудителя методом ПЦР / Л.С. Карань, Е.В.Мокрецова, Л.Д.Щучинова, С.Ж.Неталиева, Я.Е.Григорьева, М.В.Федорова, О.Б.Журенкова, Г.С.Томилка, В.В.Малеев // Инфекционные болезни .— 2015 .— №2 .— URL: https://rucont.ru/efd/323270 (дата обращения: 28.09.2021)

Автор: Карань

ь. С Цел равнение эффективности выявления ДНК риккетсий при клещевых риккетсиозах группы клещевых пятнистых лихорадок (КПЛ) в разных типах клинического материала: цельной крови, лейкоцитах крови, смывах с первичного аффекта, биоптатах первичного аффекта.

, R.sbr-pr, R.hlg-pr, R.trs-pr; смесь 3 – праймеры R.ash-F, R.ash-R, R.cnr-F, R.cnr-R, R.slv-F, R.slv-R <...> , R.hlt-F, R.hlt-R, зонды R.ash-pr, R.cnr-pr, R.slv-pr, R.hlt-pr. <...> . heilongjiangensis R.hlg-F TGACAGTGAGTGAAGACACTACCT R.hlg-R TCAGCAGCAAGCGTAAGGTTAAAG OmpB 82 R.hlg-pr <...> R. aeschlimannii R.ash-F GCAGTGACAGTGAGTGCAGATACTA R.ash-R GTGCATTAGTAATACCTTGACCTGT OmpB 130 R.ash-pr <...> R. helvetica R.hlv-F TGGCGACACAACTGCTATTAATGGT R.hlv-R TCCGCAATAACGATATGACCTATATTACC OmpB 150 R.hlv-pr

100

№2 [Молодые в библиотечном деле, 2015]

Журнал для тех, кто полон идей и устремлений, кто готов узнать новое и делиться своими знаниями. Обмен опытом, экскурс в историю, мероприятия - все это в мире библиотек.

, Интернет — PR, PR на телевидении, радио PR и др. <...> В своей PR деятельности МИБС Кемерово использует ряд PR-мероприятий. <...> Проблема оценки эффективности PR-кампаний и PR-акций всегда была очень дискуссионной. <...> показатели результативности PR: 1. <...> PR для заказчика: Принципы работы с PR-специалистом [Электронный ресурс]/ Д. И.

Предпросмотр: Молодые в библиотечном деле №2 2015.pdf (0,1 Мб)
Страницы: 1 2 3 4 ... 650