72 УДК 582.579.2 PLASTID SEQUENCE DATA SUGGESTS THAT THE GENUS ROHRBACHIA (TYPHACEAE) IS SISTER TO TYPHA S. STR. (TYPHACEAE) E.V. Mavrodiev, P.S. Soltis, D.E. Soltis Plastid sequence data ( atpB-rbcL spacer) suggest that the genus Rohrbachia (Typhaceae) is sister to Typha s. str. (Typhaceae). <...> Molecular data, combined with morphological evidence, argue against the treatment of Rohrbachia at the rank of section and suggest, instead, generic status. <...> Introduction The genus Rohrbachia (Kronf. ex Riedl.) Mavrodiev (3 species) was described based on Typha subsect. <...> However, A.S. Zernov postulated that this new genus is a section of Typha (Зернов, 2004). <...> Methods of DNA extraction, amplification, sequencing, alignment, and phylogenetic analyses were described earlier (Mavrodiev et al., 2005, 2007). <...> Primers for amplification and sequencing were reverse atpB-rbcL r, forward atpB-rbcL f (Shinozaki et al., 1986; Chiang et al., 1998) and originally designed atpB_ rbcL_Right (GGAATAGTGCCACAAATMGAAA) and atpB_rbcL_Left (CTCATGAATTAAGAATTCTAACAACG). <...> Results and discussion The atpB-rbcL spacer sequence data suggest that the genus Rohrbachia is sister to Typha s. str. (FiguREFERENCES Зернов А. <...> Universal primers for amplification and sequencing a noncoding spacer bet - ween the atpB and rbcL genes of chloroplast DNA // Bot. <...> Molecular data, combined with morphological evidence (Мавродиев, 2001) therefore argue against the treatment of Rohrbachia at the rank of section, and suggest, instead, generic status. <...> Dr. D.D. Sokoloff (Moscow Stare University), Dr. A.P. Sukhorukov (Moscow Stare University), and Dr. A.A. Sennikov (University of Helsinki, Finland) for good discussion and for providing samples of leaf materials. <...> Department of Botany, University of Florida (UF), Gainesville, FL 32611, USA АНАЛИЗ РЕЗУЛЬТАТOB СЕКВЕНИРОВАНИЯ ХЛОРОПЛАСТНОЙ ДНК ПОКАЗЫВАЕТ, ЧТО РОД ROHRBACHIA (TYPHACEAE) СЕСТРИНСКAЯ ГРУППA РОДАРОГОЗ ( TYPHA S. STR., TYPHACEAE) E.В. <...> Department of Botany, University of Florida ( UF), Gainesville, FL 32611, USA, e-mail: evgeny@ufl.edu Soltis D.E. Department of Botany, University of Florida ( UF), Gainesville, FL 32611, USA. <...> Soltis P.S. Florida Museum of Natural History, University of Florida, Gainesville, FL 32611 <...>